Description :
From Genome Similarity Track
Location :
Scaffold_396:7408- 12720
Transcript NameFunction/comments
Hyaar_Emoy2814012hypothetical protein

Sequence
5312 bases(100 bases per row)
GGCAATTAAATGATCTCCGAAGTTGTCGTCGGAGGCGCGATCAGATCAAGTTGGTATGTTCCTATGCTTGATCCGTCATTTACCAGGACATTCGATTCTC
TGTTGTCTCCTGGGAACTTATTTCCACAGTTGGGTGGGGACTTATTCCCTCACTAGCCTCTTTGGCTATCTCATCATCTGACACGAGTGAAATTGCTTCC
TCGCTATCCTCTGGCGGTGGTTGCGCTACCGCAGCCAGGTCTTATACGTGCGATTCTCCAATAGCACTAAGATCATCGTATTGCCGATCATTGGCAATCG
GTTCGTTGTCACTTGGGTGTTGTCCGTTTGGAGGACACCCATGCCCCAGTCCACTCGACTTATTCGAGTGGTGGGACTTGGGTGCAACCTGCATCTCAAT
GCAGTCGCCAGAATCTGGCTCCATGGTATGGAGATCAGCCACGCCATGGCCATGTGCAGTCGTACCAACGACCGAACCACACGCGAAGCCATCGCACTCG
CTCGTAGTACACCCACATGTTAGTGGGCGCTCCATGGACCATAACAAGTGACAGGCATATCGACTGTTCGTCGATGCCAGCTGACTTGTGCCTCGTACCT
TCTGAGCCACGGCAGTCCAAGGATAACATCAAATTTGTCATCCAAGTCTAATATGATGAAGTCATCATTGTATTGGACTCCCTTCAGTGTATAGGTAATA
CCCACTACACGTTTCACCACTGTTACGGATGCGCCTGTCTCGAGGCGCACCGTCATCCTCGTTGGAGGGATCTCTCGCTCAACATATTCGAGCTCTCTTT
TGTCTAGCGATTGGCATCGTACAAAGTTTTTCGACGCCCACAATCGACTAGAGCTCGAAGCGACATGCTTTGTGTCACTCCGAGTTTCAAGGTAATGAGG
GAAACCTCATTACCAGAAGCAGCAACACACAATGACTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAACTCACTTGACGCTGACCATTTTTTGG
CTGTCCGTTACGTTGTTGCGTTCGCAACAACGTCGGACCCACGCCTTGGACCTCGCTCGGCCGCTTGGCGGTTACTGTTTCCTGCGTACGTGGTACCGCG
ATCGGGGCACTGCATTCGTATGCATAGTGCCCTGTCTTCCGACATCTATTGCATTTTTGCAATTTCCTATAGTTGTTAACACGAGAGCTCTCGTTCCCCG
TGGTACAGAGGTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTCGACGGAAGATAGGAATTCGAATTCGCGTGAGCCTGTTTCACGCTTAAGTCCTC
CTGTTCCGTAACCTTTATTGCCTCTTCTAGGGTGTTGAACTCCAATCGGAACAGGTAGGTTTTAACAGGAACATCAGTCAGACCCTGCATGAACAACGTA
ATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTACGTCACGTTTACCTTGCTTGATTC
TCAGGAGTTCAGAGCGAGCCCTGAACTCCGCTCGCAGCGGCTCAAAAGTTTGCCTTAGCAGGGACTTGAAGACTTCCAACGACCCAAAGACATATGAGTC
GTGTAACTTAAGGCCCAGGGCCCACGTCTTTGCACGCCCTGCCAAGTTCGATTGAGCAAATGAGATCTGCATTTCCTCATCGACGATATGGCGAGCCTTT
ATGGCATCGTCTAGTTCCACGAACCATCTCAACAGAGAGTCTTCATCGGCTTCCTTGTACTTTGAGATGTCAATCTTTAGAGTCTCGGGTCGACGTATAC
ACGTCGACCCGGTAGCAGTGGCCTGCTGCTGTCTCAACAGTTCAAACTGTTGAGCACTATGTTCTCTCAACAGCTCTGTCTTTTGAGAACCTTGTTGGTG
AAGCAAGTTTACTTTTTCCCGCTCGACGTCAAGTTCATTCTGAATGAACTTGGCGATGGTGGCATGCTGTCCGTCTGGCCCCAGGGCGAACAACAGTGCG
CCAACGGCTTCTTGCCCTATCGTTGAACTCAAGCGTTCGACAGCGTCCCTTTCGATTTGACTCAAATGGGAGTAGCTTTCATGCGTGGGATGAAAATCAT
CCCCCTCATCGTCCAACATGTTCATGGTCGTTGAACGGACTACGAAGTGCTACCAGGTGTAACAGGGCACACCTTATTCAACTAACTGAATAAACCTTGC
ACTGCTGACAGTGCAAGGGTGTGTGCGTCCGACTACCTCACGTACACGTACGTGCAAAGGAAGATTGTTGTACGGAGTAAGAGTATCGGTAAAGGTAAAA
AGTAGAACTGTATTTAGTATAGTTAATCCTTTTAATAAATCCCTATTTGACTTCATTTAACTATGTCTAAATTCAAACATGTATTGTAACTATCTGCGCG
CCACTCATTGCGTGCTTCTGTCGTGGCTAGACTTTATTGGTTGATATCGATCCTATATCAACCAATGAGCAGTGTGTTACATCTGCGAAGCATTATCTAT
TAGGATAATATTGTGTTTGTCCTAACATAATTTCATACTTGATAATTACCTTATGTAAATTATCATGTAACGGAGGCACCCCGTTACATTTGCTGTATCA
CGTAATGCTCAATTGTATACATGACTAGTCACGAACCATTCCGATGGTCGTCTTTATTTCGACGAGGTTCAGAATCGAGTGCAAAGCGTGCCCGACTTTA
TATGGCGAGGCAGTAGTTCTCATCCTTGAAGATGACTGTCTGCTGGAATGGCGCCGGGGTGTTCAACAAATTCGGGCCGAATGACAGGCGCATACAAGAT
GTTGTCGCTATTTGCCGAAAACACGATATCATTGTCGCTGAGGGACTACCGGTAGCGCATCACGAGCTTTACCTCGACAAGGTGATCTATCTCCGCAGGT
AAAAAGTAGACTGTAGCGACTATCGGGCAGATGCCTTCCATTCCATTTGATCTTTGGCAAGGGTCTGTCCTAACGTAGCAAATAGCTCAATAATGTGTAA
ACGGGGACACTTGAGACATCACTTCTAGCGATGTGGTAAGTACAGACAATTTTGAGTATTGATGAGCAATCTATGAGTAGGTCGTTTTGGAAAGCCTTCG
CGGTTTAGCCGTCGAAGTGCATGCTCTGTTCGTGTGTTTTGAGATCACGTATGACACTAACATTGCGATCGCAAGCTCAGTACCAGCTGCCACAGTTTCC
AGCTGACTAGTGGTGGGTTTGGTGATACAGAGAGGAATGCGCCGCGTGAAATGCAAGCATGAGATTGTCTTGTCATGATGTAGAGGGTACGCTGGTATGA
GTAATTTGTAGTGCATGATATTGTTAGCAAAGCGACGCGTGACCCTACAACTGGTTAAGTGGTCCGCATGATCAAGATAGGTTGACGATACTCCCATCTC
CTGTGTCCGACTGCGTACGCTGGTAAGATATATCTCGTAGTAGCAGTGACTATTACCGCTTGTTCATTTTTCAATATGCACAAGGAGTCAGTGATGGAGT
CGACACCCGCTGACACTCAATCCAAAGTTTGCCAAACCAAAGGAAGTTCAGCTGAAATACTGCGCGTTGTCACCCGTCGGCGTGTCCGTGATCGTTTAGT
CAATTATTGTAGCGTAGGATCGTAGTGCTAATGACCGTGACACCTTCGCTGAAGAGCAGAGACTTTACTTGGGCCAACAAAGATCTAGCTGTCTACTCAT
TCCGCTTGTGGATGTAATAATTAAACAGACAATGGTCGGAACAACAAGAGTGAGAAGACGGAGCATGTTATGTGGCGATGGAAGTCAAAAGCTGATTTGG
ATACTGCTCTGAAGCTAGCGAGCGACAATGGAGAGCGAAAGTCGGCGCGTTTGTTGCAAGTGAACGATATCCTCCGAGATATTGATATTGTGATGTCTAT
GCAGACTTCATGCTTAGCACTTCGACAGCTATTAACTCAGACAACTTAATAGTGCATTCGGGCGTCACTGATCCTCTGCAAGGACTCGACACATTTCATC
ACCTGTAACGAACCTTTTCCATTGCCAACGCTGCATTCTTGTCTCGTATAGTATCGATCCGCTTGCAATCGCTCGTAGAAAGCTATCAAACCAATAATTA
TCTTGGTTGCGTCAGCAAATCTTTTTGTCCTAAGATCGTGTATCTAATGCTGTATCCATCTCAGAATAGTCGTCAGGCACGCCTCGCTTGATTTGGGTAG
ATTTCTTGCGTAGCGACAAAATAAAGAATTTTGTCTGCGCTTGATTCTACGCTATCCAAGTCAGGTAAAGCCCCCCCCGAAACGAGACATGAAATCACCT
AATATATCGATTATTATTCATCGACAGTGTCAAAACAAATGGAATTATAGCGCATGAAGCCATAAGAATAATGTCAGCAGCGACCACTTCCGGCGACAGT
TCGATCATTGCCATCGTCGTCCAACTCTTTGCTTCCATGGTCTTCACAAAAGTTGCCTGGCTGCTACTGTATCCATGTCGAGATGACTCATTTGCGAGGG
ATCAGCAGCAGCTGCTCGCTCCACTCTATCGCATGTGAGACCATCCTTCTAAACCCCGATGCTTTGCAGAGGTGGACATAGGATGTTTGTCAACGATCGT
GCGGATCCTCGTTTTTGTCACGAAGACGTACCTCATGACCACAGTAACAGTCGTCTCTTGAAAAATCAAATCTGCAGTCGTCACTGTCTGCTGATCAAAC
AAACCCGAAGACTGGTAAACAACCGTCGGATTCTTCACACGGGTTTCTTCCACAGCCAAACCAGCACTGAGTTACTCCACGACCAAGCAATTCACATGAT
CGACCCATGATGGGATCCAGAGCTCCTCGTAAATTCATCACAGCCCCCTCTCGGGTATCACTTCAACGCCATCGCTCTCGACGGAAGTCTCCGACAGAAC
ATGGAACATCTTAGCCGTCCCCTGAAGTGATGCGTAAACAAATTTCAGAACATGTCGCGCGTTCACGATCCCCTGCGATCAGGAGCACATTTGGATCGCG
TTCTTCCTCTGGAAATGGCACCCCTTGACCAGAAGACCAATCCCTCTTATTTGTCAAACACTTCTGAAAAAGAGAAGGAGACCCATGTGCACCTTGCATC
AGAGCTCGACAAATGCCGTCAGTACCGTTTCTGCAGTATCTGCTCGCTTCAACATGACGGTCGAGTCCACCAAAACGCTCTGCACCGGTTTGTTGACAAA
ACTTGCTGCGTTCGCGACACTCGAGTCGCTCAAGTCTGTCGATGCGACCGAGCGCACACCATTGCAGCACCAAAGGCGAGCAGCAGTGATGCCCCACGCC
TCGGTTCTTGAG