Description :
From Genome Similarity Track
Location :
Scaffold_1007:7407- 10654
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1007-snap-gene-0.5Lysosomal alpha-mannosidase

Sequence
3247 bases(100 bases per row)
TCGTGAAGCTTCAAGTTCCACGTGTCTCTGTGGTTGCGCACCCGCGAGATGAACTCGAGCCCGTTCGAGTCCGTGTACAACGTCTTTGCAGACTTGATGC
TCTTTTGCGAATTGAAGCGGATGATCACTTCTTTGCCCTTCTTGTCGCCAATCGGGATCGAACCGACTGTCCACTCGATCTCGACAAACTCGTCATCAGC
GTTCACGCGATACTCCAACGTTACCCACTTGCCGATTTGGAAAGCGACTCGGGACGCAGTACCTCCAGATGCAGCGCCATCCACTTGAAGGTCAATGAGA
CGGACTTTATCAGCCTTTCCTGCAACTGGATGCACAGTCTTTGAGTCCGGTCGGAAGATGTACGCCCCCGAACGCTGATTGTTCTTAGCTTGGAAAGACT
GGTAGTACAACACACGAGAGCTGAGCGGTAGCTCGATGTTCTTCTTCTTGTTCGTGATAGAAATGATCGAACCCGTGTCTTTTGCGATTTTGACACGCAT
TAGATCGTTCTCGAGCGTTATTTTTTCCTGAGCATCGATGTCGAGTTCCGCTGACAAAGGCTTGGGACTGTCACTCTCCCCCGCTTTCGTCTTCTTCGAA
ACCAAAAAGCGAGCTTCGCTTAGCGGATCCAGCTCCGTGCTGAACACAAGAGAGTATGGAGCCGCCATCTGATCCAGGTGTACAGGAACAGCCGCAAACA
CTTCGTGCTGACGCACTTTTGCAGAGCCCGAGATTACTTGAATGTCGACATTCTTGAACACGATCGGGATCGAGATCGTCTGCACGCTCTTCCGTGCCAG
CGCATTGTGAACCAGGACCTCGAATTGCTACACAATCAAACTCAGTCAGTCATGCTCACATAACCCATCTCGTGCTGCTACAGAGTGAACCTTCATACCT
CATTCGACGTAGATACATTGCAAGTGCTGACATTTGCAAGCAGGCAAAATTCGTACTTCTCCTTCTCGCCGATCACGAAGAACACCTCATTGAGCTCCTT
CTCAGCATCGAGGATACCCTCATTCAGACGAAGCGCGTAGTCATCAGCCACAGCCTGCTTTTCGGTTCCAGAAAGACCGTCGTGATGCTGCACCAAGCCC
ACTGCGCGCTGAAGTTTGTCCAGCTGTGCCGCGTGATGCGTTTGGTAGAGCGCATGAAGCTGGCGAACTTGCTGAAAGAGCGTGTTGGACACGCGTGCAA
ACCGCTTCAGCGCGGGGCGACTCGTGAAAAAGCCCGACCAATACTGGTATTTGCCCGATGCGTATGGGAAGAAGTCGTCGATCTTGACGCTCCAGGTGAG
GTTTTCCGCAAGCTTCAGATCCGTGTAGTACGACAGGTTGGAGTACAACACGGAGACCCGGTTGTCTTGGTTCACATAATGCTGCAAATAAAACATCAAA
CATTAGAGTGGAAATATCCAGTATGCCAAGAGTAAAAGTACGGGTTTCTGCTCATACGTACCACTAGCTTATCCATGTTCTTGTACCACCTGCGCGCGTT
GTCGTACTGGAAGTCGCCGCCCATGGGGATGAAAATGTGGTTCCCTTTCGTACTCACGCCTCGCTCATGCGCCATTCTCACAAAATCATCCACTTGCGAG
CAGACGTTGAAGTCGTGCAATTCGGAGTCATCCTGGATCTGGCGCTCTCGGTACGCAAAGTCAAACTCAAGCGGTGGACCGTAATGATTGATGATCTCGC
CCGTAAACACCTGCGAGTGTTTCCCACGCGACTTGCTCGGTCGCCAGATGAACTCGAGGTTTTGCTTCGACTTACGCAGCGCGTAGTCCTGGTAGTCGAT
GCGTGCGAAGTAGAGCGCGTCGAAGCCCACCCCCGCTGAGAGCAGCGACCCCTGCGTGGACGAGTGGCCGAAAGGGTCGATCTGCCAGCCAATGCGGGGC
GTGATGTTGAACTCCTCTCTAAGTAAATGGTGGCCGTACGCAGTCTGGTCTACCATGGCGGTGTAATGCGGTGTCGCCTCATCGTGCATGCACCAGCCGC
CGTTCACGCTCAGGTCAAGTCGACCTTCCTTGACCAGCTGTTTCACGATCAATTTGGTCTCCGAGCTCTGCTGGTGCCACCAGCGCTGGAAGAACGACTG
CACCGGCGAAATGATAGTTAGTTCGAAGCGCTCTGTCAATCAATCAATGTATCGAGCGAGCAACATATACCTGCTCGACAAACATGAACTGGCGGTTGGG
GTCCTCCAAGAGCTCCTCCACCACCGTGTCCAACGTGTACTGCACGCGCTGCATATAGTACTGGTCGATGCTAAACAGCCATCCTCTGCACACACACACA
GATACGAATATAACAAGTCAGCACACAACACATAGCGTTCATCCATGAGCATCGATACGTACGGATCGTCGTGCGAGTGCGCGATGAGGTGCACGTTGAG
CTTGTGCGGGTCGACCTCCCCCTTGGTGTTGTATTTGCCATCGACCGGCAGCGTCCACCTACTCGCATTGCAGCGTTCTGATGACTTGAGCAAGGGCACA
GCGCTGTGCCCGGCGACCGCAGAGGCNNNNNNNNNNTCGCTGCCGCTGTTAGAACCACAGCCCACGCGAGTACTCGAGTCGCGCGCATGACGATGGATGA
GCTTGATGAGCTTCCTCTCAGTCGTCCTTTGCTTATCAATCTGACTCCGCCTTGTAAACGAAAAAAGGGAGAAGATCATGCCACTTCAACACCCATCATC
CAAAGTAGCAACTGTGTCGTGGGTGGTGTTGATTTGGGCAGTAGACCCTCTTTATATGCATATAGAGACCCTCCTGTGCTTGGTGCACAAATAAATCGGC
ATGTGAATCAACGGGATTAGAGGGAAGTTTGCTAAAGACTACTCAGGAACGAGCAGAATGCTCGTTCCGGCAGCTTCACCTTGGAAATGTTGAAGTGAGA
GGTCTTGGTGGGTGCTGCCTTGAAGATGCCAAGCCAGAGTTTCGAATGCCCAACTTATCCACGATTAGCAGCATATCAAAAGTTGGTGGGCTTCAGAGCT
TTTCATTCTAGGTGGTCATTTGAGAACTTTACACCAAAGTCCGGTGACGCACATGCAGACCACTGAAGTTACCAATGGAGCGCCGTTGAAGGTAGCCTGG
CAAGTGTTTGACAACTTACAACAACGTGAATTCAGCAGGGTGGAGATGCCACCATCGCCAGCTCTAATAGTTTTACAACCATAGTGGCCAACATTGTGAC
AGTGTGTCACGGTGTGAGAGCCAACTACACAGCGTAAAAGCGCAGCG