Description :
From Genome Similarity Track
Location :
Scaffold_708:7404- 8550
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_708-snap-gene-0.13Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_708-fgenesh-gene-0.2DEAD/DEAH box RNA helicase

Sequence
1146 bases(100 bases per row)
CGGAACGAGGCCAATGGCGGCGGACGACCTGCTGCACAAGAAGGGCAAGAAGGGCGGCGGCGCCGGCGCCGCGGGCGCGGCCAGCAGCACGACGCATGGC
AAGAGCAATGGCAAAGGCGCGGGCGTCGGCGGCTTCCAGCACCTCGGGCTGAGTCCGCCGGTGTTCCGCGGCGTCATGGCCATGGGGTACAAGGTGCCGA
CCCCCATCCAGCGCAAGTCGCTGCCGATCGTGCTCTCGGGCAAGGACTGCGTGGCGATGGCGCGCACGGGGTCGGGAAAGACCGCCGCCTTCCTGATCCC
GATGCTCGAGAAGCTCAAGGAGCACTCGAAGAAGATCGGCGTGCGCGCGCTCGTGCTGTCGCCGACCCGCGAGCTCGCGGTGCAGACGCTGCGGTTCGCC
AAGTCGCTCGCCAAGTACACGACCATCAAGATCTCGCTGATTGTTGGTGGTGAAGGCATGGAGCACCAGTTTGAGACGATCGCGAGCAACCCGGACGTGC
TGGTGGCGACTCCCGGTCGTCTCATGCACCACCTGCAGGAGATCCCGGACTTCAACCTCAAGGCCGTCGAGTACGTCGTGTTCGACGAGGCCGACCGCAT
TTTCGAGATGGGTTTTGCGGAGCAGCTGCAGGAGATCTTGAAGAATATGCCTACGAGTCGGCAGACGCTGTTGTTCTCGGCGACACTGCCCAGCGTGCTC
GTGCAGTTCGCGCGGGCCGGCTTGAGCGAGCCAGAGCTGATCCGCCTGGACGTCGAGAACAAGTTCTCAGAGAACCTCAAGATGACGTTCTTCACGGTGC
GCACGGACGATAAGCCGGCGCTGTTCCTGTACATGATGCGCGAGTTCATCCCGTCGAACGACCAGACGATTGTGTTCGCTGCAACGCGCCACCACGTCGA
GTTCCTCTACGAGCTGCTCAAGGCGAACCACATTGACGCGTCGCTTGTGTACGGTGACATGGACCAGGCGTCGCGCAAGATCAACATTGGCAAGTTCCGC
GCCAAGAAGACCAACATCCTGATCGTCACGGACGTTGCCGCGCGTGGTATCGATATCCCGCTGCTGAACAACGTGCTCAACTACTCGTTCCCGCCGACCG
CCAAGCTGTTTGTGCATCGCGTCGGTCGTGCGGCGCGTGCTGGCCG