Description :
From Genome Similarity Track
Location :
Scaffold_164:7403- 9942
Transcript NameFunction/comments
Physo_144048reverse transcriptase

Sequence
2539 bases(100 bases per row)
TCACGACCTTCATCAGAGCGCTTCGATGGCGGGCAGTAGAACAGCAATCCAGCTTCGTCGACCTCGTAGTCATCGACAATCTTGGCACACGCTTTAGTTT
CCGCCGAGGTAAGGTCCTGCACGTCCCCACGTAGATACTTCTTGAGATCGGCAATCCACTTCTCTTCATCCTGCGCCTGGCAGATGCGCTCCGTCCGCAT
TCGTTGTACCATCAACTCATCCAACACTTGTGGGGCTGCTCGTCTCCTCGATCTCGTAACCGCCGCGATCTTGATCACCGCCGCGTCAGATCGAGGAACC
AATAATTCGTCGAGCCGGTTGAGCGTCCCCAGATCTTCGCGTTCTCCGTCTGCTGAAACGACTGATCCACCTTCCCGTTGCAGTGCTGCGCTTGCAAGTC
GATCTGCACTCTGGTTCCAGTCACGCTTCATGTGAAGAAATGCGTGGTTGGGCCAAGATCGCAATCGTTCCATGGCCTTCTGACGTAGTAGTACCAACCT
CGGAGCCTTGCACTCGATCTCTCCACGCATCTGACGGATCACCAAGTTGGCGTCGCCACAGATAATTAGGCGCCGCCCCCTGCCCAGGTTTGCTAGAAGA
TCGAAACAGAGGAGCAATCCATGGTACTCCGCCTCATTCACCGTTAGATCGATCTTGTACTCAGATGCGGCGGAGATTACCTTCCAGTCGGGCAAGCCCC
ACACAATCGCGCTGTAAGCCCCCCACTTCGCTTTACACGAGCCGATCCATCAAAGCTAACCACCAACAGTTCTTCATCAATCTCCACCGTAGGAGGTGGC
ATCGTGACAGCTTGTCGCGGTCGTTTCCGAGGAGAGATCGACGTTAGGATTGAATCGACATCTTATCGGGGCGTGATACTTGCGGCTATTACTCCCAAAA
TCTCATCGTCTCCTTTCGTGCATTTCACGATTTCCAATGTCCACGACGACAGTAGCGCCGCCCACCGGCCAAGGCGTCCCTGCAAACCGGAAGAATGCAC
CAGCCACGCCAATGTTGAGTATCGGGTCAGGACCTTGATCGATCTGGTAACCAGTTGCGTGTAGCAGACATCCAACATCCGGAGCAGTGCCAACACCTCC
TTATCCACCATTCCATAGTTGATCTCGTTCGGCTTGAGCGTGCGGCTGGTAAAGGTGACTGGCCGGTACACCCCATCGTGCTCCTGCATCAACGCCGCAG
AGATCGCCCACTTGCTGGCGTACACTACGACCACTGGTTCCCGATCTGGGTCAAAGTGCTGCAGGATCGGCGCCTTCACGATCTTGTCCTTCAACACCGT
AAATGCCGTGATGGCTCGACCCCACTTGTCACTGTCAGCTTGGCGTTCACCAGCTTCGACTTCATCTGCGCCGACCTCGATCTTGGCTTTCCGAGTGATC
TCATAGAAGTCGGCCTCACGAAGTTCGTACAGCACTGAAGCGTAGATCGCGAAGTCCTCGATGAACCTGCTGTAGTAGTTGAGACTGCCTACGAATGACT
GCATCGATCTCAGGGTGGTCGGAAACGGCAGATTGGCCAATGCTGATAGATCCTTCGGGTGAACTTCCAGTCCTTCCGCAGATACTCGATGTCCCAAGTA
GTCGACCTTCTTCAATCCCCAAAAGCTCTTGGCCACGCTGATCGGCAAGTTCCATTCCTCGCAGACATCTAGCGGCTTCTCCACCTTCTCACACAGCGTA
TCCCACGAACCGGCCGTGACCAAGATGTCATCGATATAAGATCGACGGCCCAGGACAGATGTCTTCTGCTCTACGTTTGGTTCTCCGTCCTTGACCAGAT
CGATCTGTCCCTGTCGATCTTGGTTGTCCGTGATCTTGAGGAAGCCGTAGAGTGCGTTGTCGATCAGCCGCTGATAGATCTGTGGCGCGTTCTTCAGTCC
AAATGGCATTCAGTTCCACTCGTAGAGTCCCCATGGAGTGATGAACGCGGAGATCGCACGAGCTCGATCTGTCATCGTTACCACCCAGAAACCGCTAGCC
ATGTCCAGCGAGCAATACCAGAGCACCTTGTCGAGATCCTCGAGGAGATCGTTGATCAGCGGCATCGGGTAGACCATTAAACGTGTCAGACTGTTGACCA
GACGGTAGTCAATACAGAGTCTGATGTCGACCCCGTTCTTCTTGACGATCACCACGATCGGTGATGCCCAAGGGGACGTTGAGATCTTGATCATCTTGGC
CGACAGGAGCCCCTTGATTAGCTGCTCCAGCTTCTCGCGGTACTGCGGCGCCACTTTACGGCAACGGTGAGCGACTGGCTTCGCGTTTCCGACGTCAATG
TCGCAGATCGCACCTTTTGCGGCCGGTGGTAAGGCATTTCCCTTTCCAATAAACAAGTGCTTCCGGCGCCAGATGATCTTCCGCAGCCGGTCGATTTCCT
CCGGCGTGTTTTCGCCAGGATCACCAACTTGGATATCCGTGATCACGACTTCGTCAGTCGCGGTGAACTCCGGGAGCACTGCCATTTGACCTTCGACATC
TTCCGCGTAGAGATCACCGCCTTCCGTGATGCAGACTTC