Description :
From Genome Similarity Track
Location :
Scaffold_785:7402- 9563
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_785-snap-gene-0.5Cytosol aminopeptidase
Pytar_ATCC12531maker-par_contig_785-fgenesh-gene-0.3Flagella-associated protein FAP196

Sequence
2161 bases(100 bases per row)
GACGACAAGATCGCGCTCGTAGGCAAAGGCATCACGTTTGACACGGGCGGGCTCAACCTCAAGCCCACAGGTTTCATCGAAGACATGCACACGGATATGT
GCGGCTCGGCAGCCGTCCTTGGCGCCGTGCGAGCGGCCGCACGTCGTAACCTCAAGGTTAACATTGTGTGTGCACTCGCGCTCGCCGAGAACGCCATTGG
CTCGCAGGCTACCAAGCCCCACACCATCATGAAGTCCCACAAGGGAATCACCGTGGAGAACAACAATACGGACGCCGAAGGACGCCTCGTGCTGGGCGAT
GCGCTGTCGTACGTGCAGCAAACGTATAAACCAAAGACGGCCATTGACGTGGCGACGCTCACGGGCGCTTGCATCGGTACGGCCCTCTCTCTTTCTCTGT
GGATTTTTTCCACTGCGATCACTGACTGGATCTTGATGTGTGTCTTTACTTTTGCCAGTCGCGCTGGGTGAGCACTGCGCCGGTCTTTTTTCCAACTCGG
ACGACCTTGCCGCTAAGCTCCTCGTGCGTTCTCCAACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCTGCCTGAGCACACGGAGGC
ACTCAAGGGCACACAGTCGGACTCGCGCAGCACGAGCAAGGGCCGCTACGGCGGCGCCANNNNNNNNNNNNNNNNNNNNNNATTGCCGGTCCGTCCAACT
ACAGTGCCGCCAAGTCGTACTTTCCCGCCGGCGCGACGGGCTTTGGTGTGCAGTTGCTGTACAGCTACGTCAAGCACCACGAGGCCAAGCCGTAACTGAG
ATCTCATCCAGAGCATAAAAAGGCAAGCGCTAGAGTACTAGGCGGCGTATTTTAGGGGGTGTAGACATTCCACACGAATACACTGCCGTCGTCGCCCACG
GACACAAGTTGCCTGTCGTCCGGACTGAAGGCAAGGCTGCGCACGCTGCCCGAGTGGCCAACCCCGTCTATGAGCAGATCCCCCGTCAGGAAATCCCAGA
GCTTGACGAGACGGTCATTGCCGCCCGTGGCAAACACCCCCAGCGAGTGGGCGACAGCGAGGCATGTGACCTCTTCGTCGCCGTGGGCTCGTTGGATAAC
ATTCACGGGCGCGTCGTCGATGCGCAAGTCCCAGAACGAGATACGCTTTTCCTGCCCGGCGCTGAGCACGAGCTGCTGGTCGCGAGAGAGCGCGACCGTG
TTGAGGCCGCCCATGCGCTGCGTGTGGCTCGACACGCGGCGCTCATTGCGGAGATCCCAGCACAAGATACTTCGGTCGCGGCTGCACGATAGCACGTGGC
GATCGTCCTGGAACAATGCGAGTCCAGTCACGGCCATGGCGTGTTCCTTGAGGTGCGAAACTAGGTCGCGCTTGCGTAAATCCCACACGCGCACGTCGCC
GCACATGCCTGCCGACACGACGAACCGCTGGTTGTGGCTCAGCACGAGCGCCGTGACGCCGCCTGTGTGGGCGCTGTCGATCGTCCACACAGCGTCGCCC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTCCAGCCAGAGAGCAGCACGTCGAGCGAGAACTGCAGACACGTGGGGTATCC
TGCATCGGCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACGCGTCCCAGATGCGGAGTGTGCAGTCGCGCGAGATGGTGGCGAACCGGTCCGA
GACGCCCGCCGCATACGCCACTTGAATGACGGCGCTCGAGTGGTTGCTGAAGAGCATGCGTGTCGGCAGGTGCCGCTGCTGCTGGTTCGGGGGCGTCACG
TGGACGAGGAAAATGGACCCGGCCTGGGTGCCCACCACAGCTTCCGACTGCGACGCGTTGAGCGCGAGCCCCGCGACCGGCGCATCGAGTGTCGTCATGC
TCGAGTCGACAAAGTCGCTGGTGAACTGGACCACTGTGCCATCGCCGCCACCGACCAGCACGCCGTTGTGCACGAACACGATAGAGTTGACGCCGCACGA
ACACGCCGGCACGCTCTTTAAGAGTCGCTTGGTCTTGACGTGGACGACGGCAAAGTCGCCG