Description :
From Genome Similarity Track
Location :
Scaffold_55:74013- 75647
Sequence
1634 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTCGTAGTCCGTCCAAGGACCACAAAACCCGTTCAACATGAACATGTTGGACGACGAAGGCAACGACACCATTCACGGCA
CCCGTGAAAGTTACTCCTATTTGAGCGATGTCGAATAGAGTGCGGTCAAACGAATGAGTTCGAACGTCGGCGAAGAAACAGTCTGGTTTCTGCTATCCTC
AAGGAATAGAGACTAATAGCATTCCATAATCGCCAAGTTCTTGCAGCGAGAACTTGACGCGTCGCAAGCTGAATTGGCCCTGCTGCATCAGCACGTCACC
AGCAGATTGAGCTCCTGAGACAGCAACAGTCTCAGTCTGCTACTGCAGCGTCGACACGTGAGCGTCAACGCGAGACTCTAAAGTTAGAAGTCTCCAAGTA
CCGGGGAGTCGAGGAAGACTCCCTGTTGAGATGATTCCTCGAAGTGGGCGATGTCGTTAAGGCTTGCCACATCGACGATGAGGAAATTCAAGTTGCATTT
GCCAAATCGAATGTTTCAGGGTGTGCCAGAACTTGGGTCCTGAATCTTCAATTACAAGATCCAAACGTGTTTGAATTGTTGGTGGTCGTTAAGACTCTGC
TCAGCCAAACGTTTGAGCCACCAAGAGCTGAGTTCAGTATTCTTTCAGAGCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCTTACGCTCAGCA
TGTTCGTTACCTTGCAAGTTGCATGGTAGCGAATCCTGTAGGTGAATTCGTGTTGATCACGATATTCTTACAAGGCCTCATAGATGGTCCCGTGGGGAAC
CACCTATTCCGCATCGAGTTGAAGTCTCTTGAGGAATCGTTCACAACTGCGGTGCAAGATGACTTTAGTGTGAGAAGGCTCACACTAGCTTCACCCCTTA
TCGTCCTTCGAGACGAGTAGAGGCGAGAGGTCCAGAACCAATGGACCTCTGCAGTACTTAGAGCGAGAGACCTCGTTCTTCGAGCAGTAAGCGATTGAAA
AAGTGCAATCGCTGTCAGAAGCTAAGACACTACGCCTACGAGTGTAGTGCTTCACGCCCAGTGTCTCGAAACACTGAGCGAAGTGATCCACCGTCTGCCA
AGAAGGGCAACGGACGCGGGTCCGACGCTGTTGCGAAGTCACAACAGCGTAGCGGAACGTCAAAAAAACGGTCGGGGTCAGTAGGGGCGGAGCGTCCTAC
TGATCCAGCAACCTCAATATAATTTGCAAACCTATTGATGAAACTTGCTCCAGACTCACAATCCTTGTGTGTGTGTCTGCACTTGATGATGAGGGGTACC
TCATCACCTTGAATTTAGAAGTGACAAAAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGGCGTCGAAAAACTTTGTTCGTCGTCAGTCGCTAGAGGA
TCGTAGGCTCAAGTTCGTTGAGCGCATTAATCCTCCTACGAGGTTGACGGTGCGCCTCGCAACAGGCGCATCAATACCAGTGGTGAAACGTGTAGTGGTA
TTTAACTACACGTTAGAAGATTTGCAGTACAATGATGATTTCATCGTACTTGATTTGGATGACAAATTTGATATCATCCTAGGGTTATCCTGACTCAGAA
GGTACGAGCCAAGGGTCATCTGGCAGCATCGAAC