Description :
From Genome Similarity Track
Location :
scaffold_34:740055- 742249
Transcript NameFunction/comments
Plaha_PHALS_09197hypothetical protein

Sequence
2194 bases(100 bases per row)
CCTTGGAATGGAAATAAATCATgtaatgaagaagaagacgctAACTATATCACAAAGACACTACATCTAGAAAGTAGCTAAGCGTTCCAATCAATCAAAT
GCACAGCCAGCCCAGAACCCAAGTGATAGTGGAATGAAGTTTAGTCGAGATGACTCTCCAAAGACAACGGATGAGAGAGAAGCAATGGAGAAACGACTAT
TTCGTTCATTGATGGGTTGTCTACTATACGTTGTACTGGGTACTAGACCAGATGTATGCTATGCTGTATCTCATCTCAGTCGTTTCCTGGTTTGCGCTGG
CCAGGCACATTGGAAGGCTGCAATTCGTATACTGCGGTATTTGTATACAAGTCGATCTATCATATTGACTTTCAGTGGGGGTCTTTCGGAACAATCTCTG
GTTGCGTTTAGTGATGCAGACTGGGGAAGCAATGTAGATGATCGACGATCAGTATCTGGTGTTTCGGATGGTGGACCGGTTGTCTTTAAAGCAAAATATC
AGAAGACGGTTGCATTTAGCTCAGCTGAAGCAGAATACATGGCTTTAAGCCTATGCACACAGGAAGTCGCTTGTGCTCTAACGTTAATGAAAGAACTTGG
TTACAAACAGTCAAGTCCAACGGTAATCTATAAGGATAAATAGGGATCCAGTGCCTTGGCGCACAATGTCGGTTACAATGCACGTTCAAAGCATATTAAT
ATTCGCCACCATTTGTCCGTGAGCGCGTCTCAAACGGTGTATTTGAAATCAAATATATCTCGACAAACCATCAACTTGCTGACATGATGACGAAGGCATT
GGCGACAACTCGTTTCACTGAACTACGTGCCTCCAGTGGTATCAAGTCCTTATCTGATACTAAATCAAGcatgagtgggagtgttaaAAAACACGCTAGA
CACTAGGATGACAATTGCATGGTGGTAGTTGTTGTTGCAGTAGCAGTTGATGCTGACGTTGATGTTGCAACATCAACTACAAGCATATGCATGTAGCTTT
TAGACTGGATGTAATTGGATTGATGAACCACGATCTAACAGTTTAATGTATTCACTTTTAATGTCCTGCTTGAACCAACACCTGCACTAAAGTGTCATAG
ATAGCTTGATGCTTTAGCAAGTAGAACAAACTGCATAAGCTTTTTGGTCTTTATATAAAAGTAAGACAATGATCACAAGCTCTGTTGAATAACAGAAACT
TCTACGCTTGCGGCGCAATACGCTTGCTTTACTATACAGGAGATCGAGATTTACAATGGACAAGTACCAATTGATATTGTTCCTGCTACTTTAATCAACT
TGTGAGTAGGAGTAGAACACATTGTAGTCATCGAGAACAAATCTATGATCCCAAACTTGATAGTATGTAAAGCTCAAATTCGCATCCAGTTCCATAATAT
TTTTGCCTTTAGTCTCTTCATCCCGAAAAGCATGTCTTTGTTATGCTAAGATCCAGAAAGAACGCGACTTAAGCCCACGTTTTGCTTCAAACCTGTAGCA
GATCTCATGATGTGGTCACGAAGCAGCACGTTAAACGGGTCACTTGCTCCACCATGTTGTCTAAGTGACATTCAAAAGGGAGAGGTGAGGTCGTAAATTT
CATCAGGCTGCCTGGTTGATATGAATGCGAGCGCCGTGTTCCACTTGAATGTCTCCAGTCTCCTTTCGCCAAATTGTTTTGTAATGGCCATTGCTTAACG
ACCTATTCTAGGCACATGTTTCATTCCATTCGAATAGCGTCGACTTGAGACTACAATGAGCCTCATGGTACGGACACTGCCAGCCCGAGATATTTTGCTT
AAACATTGCTGTATAAATGCAGATGAGTCGTGTTTGAGATGCTCACAATGCCTTATTTGACCAAGCGCGAGCCAAGGCATTTGCACATCAACTTGTCGCA
TTCGAGCGCAAAGACAATGAGTGTCGTATCAAGGAACCTTACGCTATGCTATATACACGACGCCTGTTAACAATGTTGAGCGACTACATGATCTTTGGTG
ATTTAACATGCGCGTAAGCTAGGCGACGACACGGGTATTAGAGCACGGGATAAACGAAAACTTAATTGATTATACGTGTTGCCGGCTAAGATATACTCGT
CTGCATCTCTTTTGGGGCGCAAAATGAAGTGTTTATGATCGAACATCTTGTACTTCTGGATATCAGTACGAAGCTCATattacacttttgtgta