Description :
From Genome Similarity Track
Location :
Scaffold_1895:740- 3511
Sequence
2771 bases(100 bases per row)
GGCCCCCATTTCTCGTCCCGAGTGACCCACAGTCTTTCATGTTCTACCCACTTTAACCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTTG
TCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGC
CAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAA
CAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGC
ACTCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTT
GGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGAT
CCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGTGTTTCTCCCAATAACCACGTGCCT
CTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATC
ACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACC
GGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTT
GTAGAATTCTTCCATCGGACACTTGCCGACGTCATGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACAC
TTCTCACAGACCAGATGTTTCCAGCATACAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGGGCTGCCCCGTCCATGAGATCTCGGG
ATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACCCGACG
GTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTC
GGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTCCTCAAGCTCGTCTGCGTC
GGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTTCCGCAGTACCTTGGATCCCCCATCC
TTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTG
CCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCT
GGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTC
GCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTG
TGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCAC
GTCCCGTGCTCCATGTTCGTGGAACACTTGCACTTGTGGCACGGGCGCTCTCATGCCCTGTTCGGCCAGGGAAGCGATACATCGCAGCTTCAAAAGTGCG
CTGCAGGGTGCCCGAAGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGAACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGAT
AATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTTGATCCCGAGCCTTCATGTTCACAGGGG
CTTCCTGTCCTCGGCTCCTCGCCTCCAGCATGGATGCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCG
GATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTACGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGA
GGGTCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGATCCGTAAGCAGACGTAATA
GATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGCTGGTGCTCCCACCGGTTCCCTTGAATCTTCGATC