Description :
From Genome Similarity Track
Location :
Scaffold_2656:740- 2841
Sequence
2101 bases(100 bases per row)
CAAAAAGGCGGAGGCTGGGCGTCGTCGCGATCCTGTTCCTAAGTTCCACGAACGCGTGCTGAGCTCGGATCCACCGAGGCTCTACCTTGTCCGAGTTCCC
TTCCGTCAACTCCGTCCAGATTGAATCCTCTCTCAATTGGTCCCGGGGTGGATCCAGTTCCCGTTTCAGGTCACCTCCCGACGTCATGCCATGTGGATCC
CTTCCTGTATCTGGGATCTCAAGGGCCAGAGCTTGTTGGAGCTTGGTCCGGACAGCCGAGGTGGCCATCGTGGCAAAATCCACCTCCCTTAGCTTATAGA
GTACTGCCGCGAACAGTGCGTAATCCTCAATGAACTGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGGGCAG
GTCTGCCAACGCAGACAGGTCCTTAGGATTCGCCTTCAAGCCCTCCTTGGAGACTCGATGACCTAAGTAATCCACCGTGCGCATCCCCCAATCGCTCTTC
ACCTCGCTGATAGAGAGATTCCACTTAGTACACACCTTCGGTAGGCACTCTCTCGCACAACTGCTCCACGATTCCACCGGGATTAAAATGTCGTCGATAT
AGGATCTGCGTCCTAACACGGATGGAGTTCCCAGATCACCTGGCTCTCTGCTTCGAATGGATCCACTTCCGTATGACCTTCATCGGATCCATCTCTTTCG
GGTTCCGGTATTCGGGTAAATCCGTAGAGGGCATTATCGATTAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGGCATCCGGCTCCATTCG
AACAGTCCAAACGTTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGCCACCACCCAGAAACCACTGGCCATGTCAAGAGAACAGTACCAGA
GTACTTTATCCAAATCTTCCAACAGCTCGTTGATTAGAGGCATTGGATAAACCATCAATCGGGTCAGGCCGTTAACTAGCCGGTAATCGATGCACGCCCG
CTGCCCGCGGAGTCAAATGTGACATCGATGTCGGTGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAATTATCGGA
TCTTATGAAGGGCCTGCTGCAAGCCAAGATCATCCGCTTCTCAACATCCCCGTGGGCGTCTCCGGTGGTAATCATCATCAAGAAGAACGGTGTGGTAATG
CATTTCCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATCTTCCGACGTAACCGATCCACTTCCGCGGGTTCGTTCGCACCTGGATCCACTTGGATATC
ATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCAGGCCTTCTCCGAGATCCTCGGCGGGTAGCTCTGCATGCGCAGGTCGTCCG
ACAGCATCTGCTTCTGATGGTAAAATGAAGGCATACGTGCAAAAGTAGTTGGCAAAGTCCGAGGACGACTCCCACTCCTTCTTCTTGTCCGGCGAGATGT
CGCGCGGGTTCGAGTCCGTCATCTTTGAGAGGCTCTGTCCTGTATAGTGGGCAATGGCGAACAGTAAACTCTGAGTTTAACTCAGTGATGGCCACCCAAA
AGGTAAAGAGATCCCTCACTAAAGTGACGAGTGACATCAGTCACTTCTAATCGCACAGTTTTATTAAAAAAGTAAAAAAAAAATCCGCTCGACCATTTCC
CACCATGGGGGACGACGACTTGAAGCGTGCGTTCCAGGCTCTGTGCGGGGACTATGAGGAGCTTTTGGACGAGCGCGTCGGCCTGGCGTTGTTCAAGATT
GACGAGGCGTGTGCGGCGGCCGACGGACTGAGGCAGGACGCGGAGCAGATCCAGGAGCAGCTGCTGACCGAGCTGTTGAACAACTGCCATGAATTCGAGG
ACATTTTTCTTTGTGTATAAATCATCGAGGTAGGTGAAGGCTGCATCTACATTTATTTCGTAGCAAATATTAAATGTGCTTGTGGTTTTTTCTATTATAT
ACACGCGGCGTTTGCTATCGAGGACGCGAGCGCCCGAGTCACCCTTGATGTCGAAGGTTTCGTCGGCTTATGCGTATTGTTCGCTAATTCAAGCCACGAG
G