Description :
From Genome Similarity Track
Location :
Scaffold_3442:740- 2543
Sequence
1803 bases(100 bases per row)
GATCCTACGAAGGCGGAAGATGAGCAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATGCCGGAGGTAC
CACTGACCACAGAAGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGGG
CCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGTGGAGTCAAAGGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGG
GTGCGGAAGGTGGCGCCTCACTTCCGAGAAAACTATCGGATCTGATTAAGGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCAT
CCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCACAGATTACCGGCTGGTTAACGGCCTGACTCGATTGATGGTGTATCCGAT
GCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGA
GCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCATTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAA
TCGATAACGCTCTCTATGGATTCACCCTAAGACCGGAACCCCAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGTCAGGAGAGCC
AGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGCTGTGCAAAAGAGTGACA
TCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGACGCGCAAGGTGGATTACTTAGGCCATCGAGTTCCCA
AGGAGGGATTGGAGGCGAGTCCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAA
CTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGG
ATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGTATCCACGAAGGGATCCAAGTGGTACGACGTCAGAAGAGGACCTAAAACAGGAGCTGGATCCAC
CCCGGGACCAACGGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGT
CGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCA
GCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAAATACGGAGCGGTGGAGAAAG
AGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTT
CAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATC
CTG