Description :
From Genome Similarity Track
Location :
Scaffold_1011:74- 8372
Transcript NameFunction/comments
Phyag_g9105hypothetical protein

Sequence
8298 bases(100 bases per row)
accagaagagcagatcccgcccaccgacgggtacacaaggtggcaagttcagcagatcacggatcACAGGAGTACCCCCTCCTttagtcggtgtctgggc
gaAAGTTGGGAAGTCGGATTGACCCTAACCAGATTTTGGgaaatcctgctacaccacaatGGTGCGCGTGCCCGGATCTTTTGGTGACTCAGGATATCAC
CGTGAGTCCCTAGAAGAAGTTCGCGTGAAACAAGAACAGGGAGATCAAGCGTCGTCGGATCCAGGATCTACGACGACGCCGCTGAATGAACCAAGATCCG
CGGATCGACAGAGTTTTGGGAGGAACTCTGCCGACGGAAATAAGGGCGATCTGGAGACAGATCTAGAAGATAAACCTCAACATCCTCCTCAGGTCCCTTC
GGGGGCCCCCGCGGATCTCGACCCGCATCGAGATTCGCCGAACAAAACGGATCGGACTAAGCCGAAAGCCAAACCCGATCCGTATTCGTTCGCAACCCCG
CTAGTCCCCAGATCCAGtgcaaagaagaagaaatcaaAGACTACGCGGAAGCAGCTGAAAGCTCCAGAGGCTGAAGCTGAGGATAACAGTGGATTTACGT
CAAGATGGACCGATGAATCCCTGGAACATGCTTTCTACTCCAAACAGCTACATGAGTTCCTGCGCCAAGACCCAGTGATGCTGGTCGTGACTCCTAATCA
AATCGGGGATCTCAAGGGACCTGTGACGGCCCCACCGGCGACGACGAATAAACTCGTAGCCGTGAAGAATCTGCTGCGATTACTTGAAGAGGCTGGTCTC
GTAGCTGGCGCATTCGATCCGAACGACTTGTTCGATCTGGATCTAAACGTGATTGGGTCCGCCTCTTTGGACCTCTTTAACAAGCTAAAGGCCCTGGTTG
GCGAAGTGATCCCGGATCCAGTGTCGCCACCGCCGAACAATGCGCCCGATTGCCGAACAGCATCGTCACATTACGCCTCAGCTGAAGAACTCGGATCCGA
CAGCTCGTCCGAGCCACAGCACATGTCGCTGGGTCCATCAGGCGCATCCATGCTAGAAGCCCGATCCAAGATCCAGCGTCAAGATCACGCAGGATCCCGT
AGCCAACACGTAACCTCTGCACCAACGGACAGGATCACGACCGCCACTTCAGCCAGCGAGTCGACAGGCAGGCTGGAGTCATACTTCCAGGCTGCTATGA
AGCGATTCTTGGCGGAGCAGCGTGCAGCACCCGTCCCTGTTGTAGAGATGCCGTCGAATCCTGGATCCAGAGACGTCGACATGGAATCCGTTGGATCCCG
AGATCACAATTCGCTCCGCGAAGAGTACGACCCAGATGACCTGGACTTTCCAGTCTCAACACGTGCTATGGCGATGACTTCGGCGACTGGATCCACAGGT
CCCTCGATGATCCAGCGAGTCCGGATCTCGGCGATCTCGGATCTGAAGGAGTTCACCGGCAAAGATCAAGACGAGGATCGGGCCCGAGCCTGGATCAGCA
AAGTCAAGTCAGCGTTTCAACGAGACCAAGCGTCAGATGAAGAGAAGTGCTTGACCTTCGGCGACTTGCTGGCTGGATCCGCGAAGAACTGGTACAAGCA
GCTTGGGCGATCCACCCGCAACAAATGGTCGGATCTACTTCGCAACTTCCAGACCCAGTACTGTGGTCTTGGTGTCTCTGTCGCTCGACAATATTCCCAC
GCACGTAGGCGATCCGACGAATCCCCGTTGGATTACCTCTACCGCCTCAATGTAGCAGGCTTGCGTGCGCGACTGAAGGTCAAGGACGGTGAATCCAAGG
ATCGACGTGAGCACGTGGATCACTTCATCGAGACATTGGGGGATCCGGATCTGGCAGATCGGCTGACACTCTTTCGACTTGCGGATGCTGACGAACTGGA
GGACGTCTTGCGCGCGCTCGAGCGGGCAAAGAATCGACAGAAGCGAGCTGCGTTTGGATCCAGCAAGTTCCGACAGAAGGCATCATCACCTTCACCTGCG
GCACCGGCCAAGCAGGTTCGCGCGATTCAATTACAGGATCTCAGCGCTACATCTAACTCTGGATCCGACGGATctgacgacgaaggtgatCTGCGCCAGA
TCTACCTCGCCGCCAGAAACGAACGCTCATCGGAACCCGCAGAAGATGTAGTCGTTACGGATCCGACGACTCGAGACCACGGGTCTCGGATCCAGAGCCA
TGGACCCGATCGAAGTCGCTGCTCACACTGTGGATCCCGCAAGCATTTGGAGCTGGATTGCTGGAAGATCATCACTTGCGAGAAGTGCGGTAAACGCGGG
CATCCGGCGGACCACTGTCTCTTTGTGTGCCGCGGATGTGGTGAACTCCACGACATAGGGAAATGTCCGATGGAGGAGTTCTACAACCAGATCCGCCAGT
GGTACAATCCGAAGGACCACGCGGGCTTGCTGCCCGAgatggccgagaagatgttAAACTAGGACGCTCGCCGGGTTGGAATCCGGTACGAGCCGAGCGT
TCTAGGTATTGCATCTATCCATTTGTGAACAAGCAAGCAGTAGATCAAGTTAGCAAGTGACCAGATCTACGCGGTAATACATGTGATCTGCATGCAAAAC
GTACTGCTGTGGTCTCAAGTCTCCATGTCGACGAGTTCACCAGATCCGTTGCCACCACGGCCTTGGCACTTGGCCCTGATGAATGTCGAGGTTACTGGAA
ACAGCAAACACCGGATCAGTGGTTCAAGCCTGGAGACGGTGAAGTCACACCCCAGACCCGGGGATCCGGTCGTGTCGACATGTTCCGTGGATCCAGCGCT
AGGCCGACATTGGATCTCCTCCCAGGAGAATCCAGAGGTTATTGGAAACAACATGCGCCTGGCAAGTGGTTTCGACAGGCCAAGATCACTGGCAAAATCA
ACAATATCAAGGCGATCCTGCTATTAGATACTGGTGCCGAGGTGTCCATCGTGGACACCGCCTTTGCTCGTAAGGTCGGGTGCTGTATCGACACAAGTCA
AAGCCAAGACTGTGTTGGGATCGGTGAGAATTTGTACAAAACAGAAGGGAGAACTCGGATCAAGATTACCTTGGCAGGGTGGCTGGTATATTTCTTCGAC
ATCTGGGTTGGAGATCTATCGGGCCAAGAAGCGATCTTGGGTATGGACTTCATGGTCCCGACTGGGATCCGGTTGGATCTGGCCCAGGGATCCATGTGCC
TACCCGACGAAGTCAAGATCCAGCTTAGCGGACGCCGGCAACTCTACAATGACAAAGCCAGACACCTGACGTCGGATCGGGACTTGTGGGTCGATGTCGG
AGAATCCGTGGATCTGCCCATGCGCCTGCAGACGTCAGATCACGAGAAATTGTGGGTCACACGTGGAGATCGCTGGGTACCAACAGTGATCCGAGGACCG
GGCAAGACACAATACCTGCAAGTCACGAACGTGAGCGAGAAGAGGGCGATTGTGGACCGACATACTCAGATCGGCATTTGGCTCGCCGGCGATCGTGTCC
CACGTCTCCCAGGCTTCGTCAGTGTTGGGTCTCGTCGCTATATGGAGTGGCAAAACTTAGCTTTCCAGGCCACCACGGACGCCGGATCCAGAGAGAGGGA
GGtgtcagcagcgccggcgGAGCCCGCCGTTGAGCGTCCGGAGTACCCCACGCCGCGTGCAATGCTGCGTAGACCTGTGATGACACGGATCCAACGAAAC
TTGTCCGCTCAGACCCAACACGACATCATGGATCCAGACGTTGTGGATCCAACGCCTGTTGATGTGGATCAAGCTGACccagacgctgcagtggatCTAG
ACGTGGCGAATCACTCCCCCGTAGATCCAGCCCAAGTGAATCCAGATCCCGCGGACCCAGTTCCTGTGGATCCAGACCAGCTGAATCCAGCCACTGTAGA
TTCTACACCTATGGATCCAGCCGCCGCGGACCACGTGTGCTACCACGAGAGTGGCGACCTATATGCAGAAGATGTCGAAGGGGAGATGGCCGTGCTGCCA
GAAATCACTCTGGCGGCAGACGAAGTGAAGATCGTGGATATCCAGGTCGGGGATCCAAGGGCTACCCCAGAGGAGGTCGATAGGTTACGCCAGAGGATCT
GGCGCTACCGACATCTCCTAATCGGCAAAGGAAATGCGTTGCCACCGGCGGCCAGAGGCGTCGTGTGCGACATTGATGTGGGTGGTGCAAGACCAATCGC
CCAGAGGGTACGAAAGGTGGCTCCACAGTTTCGCGAGAAGTTGTCGGATCTAATCAAGGGATTGCTGGGAGCCAAGATTATCCAGCATTCGACGTCTCCG
TGGGCGTCGCCAGTGGTTGTGATCATCAAGAAGAATGGCGTGGATATACGTTTGTGTATTGATTATCGACTGGTTAACACTCTCACTCGACTGATGATCT
ACCCGATGCCGCTGATTAACGACCTGCTCGAGGATCTGGACAAGGTTCTATGGTACTGTTCGCTGGATATGGCAAGTGGGTTTTGGGTGGTGACAATGAC
GGATCGAGCTCGTGCGATTTCGGCGTTTATCACTCCCTTTGGTCTTTTCGAGTGGAATCGGATGCCGTTTGGATTGAAGAATGCCCCGCAGATCTACCAA
CGATTAGTGGATAATGCGTTATACGGATTTACGCGGATCCCGCGATCTGATGACACTGGAGAGACCGTGGATCCATTTGAGGCCGGAGAACCGGAGGGTC
CAGGCAAGCCATCGGTACTAGGACGCAGATCCTACATCGACGATATCTTAGTGACCGGTGGATCTTGGGATCATCTGTGTGACCGGGTTGACGCTCTGCT
GGAGGCGTGTGATAAGTGGAACCTGTCGATCAGCGTGACAAAGAGCTTCTGGGGGATGCGTAAAGTGGATTATCTGGGTCATCGTGTGTCGATTGAATGG
CTTGAGGCTAATCCAAAGGATCTACTCGCATTGACGGATCTACCGTTTCCAGGAACGCTTAGATCCATGCAGTCATTTCTGGGTAGTCTGAATTATTACA
GTCGCTTCATCGAAGATTACGCGATCTACGCTGCTGTACTCTACGAGCTGCGCGAGGCAGACTTCGctgcgatgcagaagaaagATAACCGCGAGCGGAT
CGCGACCTTCTTGCGAGACGATGTCAAGTCGGATCCAGATCTTCGGACCTTGGATCCAAATGCTGGAGATCCGAGATCCCCGGATCAGGGGATACCGGAG
GCGAAGACTAATGATCCAGAGGAACCAGTATGTGGAGATGATGATCAACTTGGAGGCGCCACTCCTGTTAGCAAGGTGGAGTCGGATCACGTGGGATCGG
AAGCATCAGACCTCAACCGCTCGGATCCTCAGAAGAGCATGAAACCTTTGGATCCAGGACCAGGGTCGGCAGATCCTACTGGTGTAGATCAGCGTTGGAT
CCGTGCCTATAGGGCGTTCGGAAAACTCAAGGAAAAGATCACGATGACGCCCATCCTGCGTCATTTTGATCCAGATCTTCAACCGGTGGTCGTTGTGTAC
GCAAGCGATTGGGcgatttctgctgctctagTACAGGAGCACGACAGAATCTACCACCCGGTGACTTTCGCTAGCCGTACTCTGAAGTCGAACGAGCTTA
ACTACGGTGTGGTTGAGAAAGAAGTGCTCGCATTGTTGCGGATCTTGGATCTGAACTACAACATGTTGGTGGGTCGGCAGATCCGAGTCCTGACACGGCA
CTCCACGCTGGCATGGCTCTTCAGATCCGCGGGTCTTCAGGGACGACTAGGCCAGTGGGCGGCTTTGCTATCACCATGGACATTCGAGATTGTTAAGTGC
ATCAAAGGTGAAGACGAGATCCTGGGGGCGATCGCGGCTAGCATCACTCCCAGATCCGAGGTGGATAAGGCGCTCATTTCGATCGCACCCAAGAAGGAGC
CACGCCGCCGGATCCAAGTCCCAATCCCAACTGTCGAATCTGACGAGGAACTTCACGTGGTGAGCTTCGACGGGTCGGCACGTGTCAAGCGTGGTGGAGG
CGCCTTCAGCGCGATCCTATGGAAATTGCCTGGGTGGACAGTGGTGAAAGCCAGATCCGGCTACGCTGAGGGGTTGACTGTGAATGAAGCGGAGTACAAC
GGGCTGTTAATGGGTTTGGATCTGCTCGAAAATATGGATCATCAACGCCTCGTGATCTGCGGAGACTCCAACTTGGTGATCCGCCAAGTGAGAGGAGAGA
TTGACTGCAAGGCCCTGGACCTGACGCTTTTGAGGCAGAAGGCTCTGGATCGGCTGCGAATCTGGCCAGACCACGAATTAGTACATGTGAAGCGCGATTG
GAACGGCAGTGCAGACAGCTTGGCGAGCGCGGCACTTCGAAGACAAGACGGTGTGGAAGTCATGGAGTCTGAGTGGCAGGATCTTGTCACACTGAATCGA
CTCGACGAGATCCTGGTAATCAAATCTGAAGATCCAGTAGCCCGGGTTTCGACAATGACGACTAGGTCTGCTGGTAGATCTCGATCCAACCCGAAGATCC
TACAAGAAGAGATTGTGAAGAACTTGCGGGTTGAGCGGATCCGGCAAGCACAAGACGAGGAGACGTGGATCTCAGGCCTGAAGAAGTATCTGTTGGGTGA
AGTGCGTGATCTGACCAAAGATGAAGCCAGATCCTTCAGCAATGTGGCCGCGGATTATGAGGTGGATCTAAACGATTTGCTCTTCTACTGCCCACCTACG
GCGAGGACAGATGCAGATCGGGATGGGTTGATGAGACTAGTCGCACCGGAAACGCTTCATCGAGATATCTTGCATCATTACCATGCGAGTCTGGAAGGTG
GGCACCAGGGGATCGGACGCACCTATCAGCGCATCCGAGATCACTTCCATTGGAGAGGCTTATTCCGATGTGTTCAGAAATACGTCGGAGAGTGTGTCGA
CTGCGAGACGGGCAAAGGACGACCGACGATCCGTGGAGAGTCACCAGGGAACATCCAAGCGACCTACCCGTTCCAGATCCTGGCTATGGATCACATCCCG
TCGTTACCTAAATCTTACAAGGGCAACACGGAATTACTGATGTGGGTGGATCTGTTCTCTGGGTATGTGATCGCGAAAGCTAGCTCATCTCGAACGGCCC
AGACGATTGCAGAATCCTATGAAGAATGTGTCTTCCGAAGGTTTGGGGCGAGTGAGATGATCCGACATGACCGCGAGCCGGGATTTATGTCGGATTTCTT
TCGTGCATTTAACAGGATCCTCGGTCAACGCCAGCGTGCTACTATGGCTTATCGTCCACAGGCGAATGGAACAGCAGAACGCATGGTGCAGACGTCGACC
CGAGCACTAAAGATGTTTGTCCAAGATCTGAATCAACGGGACTGGGACGAATACGCGGAGAGGCTAACCTTCGCAATTAATACGGCTCATGATCGGATCC
GTGGAGATACCCCGCATTATTTGGTGCATGGGTGGGATCCCAGATCCACATTGGAAGCTACGATCCCAGTCGGTAGTACTCGACGTCAAGATCGAGATCC
ACGCCGCTGGCGATACCAGATCCAACGGTATTACCAACAGGCGCGAGAGCAGGTCAATGCACGATTACGAGAGGCGATCTCGGATCGGGCTGACCGCCAT
AATGAAGATGTGCGCCCACACTTGATCGAGGTTGGATCCCGGGTGTGGCTGTACTTGGATCGCGTGAAAGAAGGGTACGCCCGAAAACTTGCACATCTTT
GGCATGGACCGTTCCGGATCGCAGAGAAGGTCAACGAATTCACGATGAAGCTCGAGATTGCTGGCACTGGGTATCATATTTTCCCGGTAGTACATgtgtc
gaagttgaagctggtaAAGGAGTTTCCGGATCGACCACGAATCCAGCTGACTGTGCCAGAAGCAAACCGCTTCGATTTCGACGAGACCCTACTACCGGAA
GATAGCTGGATTCCAGATCAAGAGGGCGATGAGTTCGAGGTGGAAAAGATCACAGGTATGCGAAGTGGTAAGAAGACGAGATACGGTCGGATCTACCGTG
AATTCCTTGTGCATTGGGGTGGCCATGACGAACCGAGTTGGGTTGATGAAGCGGATCTCAACTGTGGCGCGTTGCTGCACGAGTTTCTGCGGGATCGCGC
GAACCATAACCGGTTCAGTGCGATGCAGTCTCACGAAGAACAGTGAGGCTGGGATCTGTTGAAGTGAGCTGGTCACTTTGACAGAGGGTTGTGTGGAAGG
GTCTGCAGGAAGGCTGTAGACTGGAGGAATGGGTTGTATGTTAATGAGTGTGCAAGGTGAAACACAGCTGGTGCCGAATCCACGTGAATCCAAGATGG