Description :
From Genome Similarity Track
Location :
Scaffold_1909:74- 3502
Sequence
3428 bases(100 bases per row)
GGTAGATTTAGGGGGCGTTTATTCAATTTAAACCGCATCCGGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCC
GTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATCAGAGGCATTGAAT
ACACCATCAATCGAGTCAGGCTTTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGCGACGCCCA
CGGGGACGTGGAGAAGCTGATGATCCTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGA
GCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGCAGATGTCGGCTTTCCC
AGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCGGTGGTCAGTGGTACCTC
CGGGATTACCGCCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTCTTTGTCTTATCCACCCTT
GGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCATCGGTCGGATCCAGCCGGT
CCTCTAACGAGTCTAAACCCGAAAGTTCGGGTTTGACTAGCGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAAAGCTTGGATCCACTTG
TGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTC
ATGGATCCAACCTCCATTGCTTGGATCTCAGCCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTG
GCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTCTGTAGCGGCGGGATCCCACTGACAC
ATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGG
AGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTCAACCGGTCTG
ACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGTCGTCCGCTGAGTTGGAT
CCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCG
AGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCAATCC
CAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAG
GATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTACCCGCGGGACTCTCCTGTTAGC
AGATCCATGGATCCAACATCCTCAGATCCATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATC
GACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAA
ACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAAT
GCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCT
GTGCTTGGCTTGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACACACGTAG
AAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTTGGTGTGCTTCCGGGATCCGCACTGTGAAC
ACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGAGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGC
CGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCGTG
ACTTGGTGAACACGTCGAGCTGGGCCCGTAAGCGTCGGAGCTTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGAT
CCACCGCCCGCAGTACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATG
ATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAACGGGGAT
TCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGT
TCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCT
CATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGAGCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCCGT
ACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCAT
CATGGGAGTTGTCCCCCTCTACTGACTC