Description :
From Genome Similarity Track
Location :
Scaffold_219:74- 3186
Transcript NameFunction/comments
Hyaar_Emoy2812806PREDICTED: la-related protein 7-like
Hyaar_Emoy2812807conserved unknown protein

Sequence
3112 bases(100 bases per row)
CACACATGCACAAGGTTTTTAGCCTATGGGTTGGGTGCGGTAAGCGCCGATTTGGAACTCCGGTGTGTACGCATCAAAGGGTGGATGTGTACCCATAAAT
CTACTTTTTTCCTAAAAATTTACGTCAAAGAGTGACGAAGACGTTGGGGCGAGTTCGATAACAAACGTAGCTAAATATTCTCGACAAGGTACGATTACTA
CTATAATCCCGGCAATGGAAGACACGACTACAGGTAAGTCGAAGCGTAAGCGGCTGCAGCGACAGCTAGAATTCTATCTGAGCGAGAGCAACCTTCGGCA
GGACAAGTTCCTGCAGCAAGCGATGGATGATAACGGCTTCGTGCCTGCTCACGTGTTCCTGTCCTTTAACAAGTATGTTCATCCTTGCGTCTTTTGCTTA
ACAGCCCTAATTGTAATGCCATGCGTACGTTGTGCAGGTTGAAGGTGCTCAAGGCTACCGAACGTATGATCCTGGAAGAGGCAGAAAGGTCGTCCGTGCT
TCGGGTCAATCGAACGGCTTCTTGTATTGCACCAAATCTTGTGCCGAAGACGACCAACCAGGACCATGGCACAGGTGCGTGCAAAGTACTTTATTGTGCT
CACGAGTTTGGTGCACCTCATTTGTGCAAATTGCTGAATCATTTTAAAAAAAAATTCTGCTCTAGACGCCCGCACGATATATATCGACACTGTCGGCGTC
ATGGACGACCACGATTCGCTACGGCGGGTCTTTGCTTCGTTTGGCAAAGTGAACCTCGTGAGCCTGCCGAGATTTTCGCAGAACAGAAAGTTTAAGGGTT
TTGGCTTCGTAGAGTTCGCCGATGCAGTTGCCGTTGACGAAGCTGTTGCAAACTTGTCGAATGTGGATCTGAGGGGCATTCGTGTCATGAAGAAAACGCG
ATGGCTCGACATCAAAGAACAATTGAAATACCGCCTGGCACACGGTGGTAGGGCTGAAGGCAGTGCCAGTGACAGCGCCGGCTTGTTATGCAGTCCCGAA
CGCAATAGTCTCCTAAACACGGCCGTTACGAAAACGAAAGAAAAGAAGCGGCGCTCACCAGCCTCAACGGAGCACATCCACTTCGGTGATGACATTGACG
AAGTGACTACTGAAAATGAAGTGACAACGAAGAAGCAAAAGGTATGAATAAAACGTGCAGTCCTTTCCATTTATATACGATAAGCAGCCGGGTCGACGTG
CTCGAGGTCGTACAGATGTGCAATCTTCTTCATCAACTCTTTTCGACTCTTGCTCGTGGCGTTATCAAACTGAAGATCGTACAGTGAACTGAGATTGAAC
ACGACCACACCATTCAGAAACCGCTGCGGGTTCGACTTAATCATCCGTTCTAGCGTAACTACAGCTGCCTTCACATCGCAGCAGTAAAGTGCGCACACTG
CATAATTATTGACAGCCGAGCACACAATATCCTCATCCAGAAAAACCTCAGCATCAGTGATCGTCGAACTCAAGACTTGCGCATTCTGCAAACGCAGAAT
GGAGTCAAATGCGCCCAGTGCTTCTTGCAACTTATTCTGAGCGAAAAACAGCAGGCCGTCATTCAATAGCAAGCGTGCTTTCAGCTCGCATACCACCTCA
GATCGTATTGCTGTACCACTGTCTCTGCTAGCTGTTGCTTGGTGAGTAAAATAACGAGCAGCCTCAAATAACTTCTCTGCTGCTGTCAAGTCACCCATCT
GCAAACGGATGCGCCCCACACGGGACAATACGACCACTTTATCGTTTCCATCCATATATTGAGCCTGGCGTGATGCACAAAACATCAACATCATCGTTTG
TCAATAACATGCAATACCGCAAAGGAACAGTAAGACGCGTCGACGTACATCAATCTGAGAGCAGATACGCAAGGCCATCATGAACTTTTGCTGATGCACT
AGATGATTGGCAAGCGCAAATTGTGCAATTCGGAGCCACCTCGCAGCCGCTCTCAATTGGACACCAAAAAGAGACATCGTCTCATTCTGTTGGATTGCAT
TTTGCAGTCTCAATATCAGATGGAACAATTGCTGCTCGTGATTCAAAACTTCTCCTTGGCACTTGCTTAGTAGCGCTTGAAGTAGCAGCAAACGAATGGG
CACGAACGGGGAAGCCCCACCTGCGATAGATAGTTCGTCAAGGTTTCCAATTTGGTCCAGCACGTTAGTCGCATTGTCAAACTGTCCATCTTTGATGAGG
CCGGCAAGCCACCAAGACTTAATTTCCAGTGCCACGTTTGTATCGCCTGATAAGCTCTGTAGCATCGAAAGTGACTTCTTTGTCAATGACCGCCATCGCT
TCTGAGCGTACAAGACCTCCAAACCTTCAATAGTATCAGGAACAGGCGTGCTTCCATGCGGGACCGCGTTCTCAGTACTCCCCAAACACTCAGCAATAGA
CAATTTCAATAAACCATCGGCGAACTCGTCTAAGGATGGGGCTTCATGTGTGCTTTGATGTTGAGACGGGGACCGCAATACTGCTTCAGATGGTGTCGGC
CTTGCTTGAAAGGGTATTTTTTCTGCGTCAAATATAAGTAAGTCTGGGGTAGACGCGAATGGTGCAGGAGCAAGATCCGAAAGTGACCAAGCATTGTCAT
CATATCCCAGAAAAGGAGCAGCAGGAGGAGGTGTTTGACCGAACCTATGCAAAGGCGATTGCTGCCGCTGCTGGTACGGTTCGTACTGCTGTGTTGCTCC
ACGAGGAGCTTCAGACCTGCCGGATGACGATAACGACAGGCTCTGTGACGACAGTAACGATGATGGTCGCGACAGCATTGAAGAAAACGTCATGGATCCT
TCTGGGCTATCAAATAGACTCTCGTAAGGGTCCTGCTGGGTTGGTGGTCCTGACGCAGAGCTTGAAACAACTGAATTGTCCAGTGCCATTCGATTGTGTA
CTGCAGGTACATTTTCGTGCATGTGATGCGTGGGGATTAACGGAGCTGGGACCGAAAGGCCATCAAATGGGTCAGGACGGGATCGGTCGTGCTGAGACAG
TGAAGGTCCAGTCTGCCCGAATCGTTGAAGCTCTGGTATCGTTGTAGCTTGTCCAAGCAAATTGTGGATAGCATCTGGAAGAGTTGGAGGCGCTTGCAAA
TATTGAAATGGT