Description :
From Genome Similarity Track
Location :
Scaffold_79:7399- 9319
Transcript NameFunction/comments
Physo_139822reverse transcriptase

Sequence
1920 bases(100 bases per row)
AGACTAAGAAGGAGCGCTTTGAGGAGCAGAGCTGGGACTCGCTGAAGTCGAGTCCCTTCTACGAGATTCTACGGAAGCACGCGGACGTGCTTCCGGAAGA
GACCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGA
GAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCA
AGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGTTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGCCATCAT
CGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCAATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTG
AGCACGCCAAGCAGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCT
CGGTGCGCGACTTCGCACCGTGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACAGGATGAGTGATGTTGAGATGTACAAGGTGCATCTCCG
GAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGG
AAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTAATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGTAGTTCCTTGGCTTGGCCA
CGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAACTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCA
GCAGGCCTTCGATGCAGTCAAGCAGGGCTTGACTGAGGCGCCGGTCTTGGCGGTGGCCGACCAAGATTGCCCGTTCCACGTTGTGTGCGACGCATCCGAC
TTCGCAATCGGATGTGCGTTGATGTAGCACGATCACGAGGGTCGTGATCGTGTGGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACC
TGGTGCGTGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTCAGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTACACAGACCACGC
GTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCAGGTTGAGTACAAACCC
GGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGAAGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCT
CAATGTCGTCACTGTTGGACGACGTGAAGGCCGCGTACGCGCACGACGCCGATGCGAAGCTCTTGCTGGCCTATGGCTCAGCACCTTCTGACAAAGCTCG
TCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCTCGATGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGTTCCGCGTT
GTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACACACCTTCTTC
TCACACGAGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCCTTCGCGCG
GGCTCCCTTGCAGTCACTGC