Description :
From Genome Similarity Track
Location :
Scaffold_246:7397- 11059
Transcript NameFunction/comments
Phymu_g7460hypothetical protein PHYSODRAFT_352574

Sequence
3662 bases(100 bases per row)
GCCGGACGACGCCTTCGCGCGCGAGCCCGAGTGCGGCGTGTGTACCAAGTCGTTTAACATCTTGCGGCGCCGGCATCACTGCCGTAGCTGCCACATCGCA
GTGTGCAAGGATTGCGGTCGCAAGGCTATTGACCGCAAGAAGCCTGAGCGCTCGAGGCCGCAGTGGTACTGCTTGGGCTGTTTGGACGAGGACGCCACGC
TGGAGATCACGGGCTCGAGGCCGAGCGTGAGCAAGCGCCgcagcttctcttcgtcgtcgtctttcGCCCCGAACAGCCAGCCGCAAGTCACTAATGTGAG
TGTTGTGGatgccaagttgaagtgaaaagTTGCCAGGTGGTTTTTGTATCGACTAACGGGTGTTTCTTGTGACAGTTGGCAAGCACAGCTAAGTTCTGCA
TTGAGTGCGGCAATGAACTGCCACCAAGAGTCAAGTTTTGTATTGAATGCGGCACGTCGGTCAGGCAGCAGTTGATGTCGCCCGTCAGTGTGGACGGTGT
GGCAGCGGATGGGGATCGCGCAAATCGAGGATTCCGCGACTCATTGGGAACGAATCTCATGGTTATTGACGAGAACAGTGGATCTCCGACGGAACCTACG
GACGGGTCGGAAGATGACACGCCTGCTGATCCAGAACCGGATGAGGACGTGTCGAttgagaagaaggtggaggttGAAACGCCCGAAGGAGACGAGAAtg
cagctgcaaaagcaaaGGAGTACGAAGAAATGGTAGCGCAACTACAGGCGGAAAACGAGAAGCTCCGTACTCGCGTGGAGAAATTTAAGCGCAAGATCTC
GGAGGCAGAACGCCGTCGATTAGAGAGAGAAGAGGAACACGCACGAGCAGTATCAGAggccactgctgctgcagctgctgctgctgctgcaacggcCGTT
GCCGAAGCTCAGACGAATAATCGTAGCATGACAGAACCGGCGGCTCAGACTGCATCTGAATCTGCAGTAGAAGCAGCTCCCACTGGCAATGGAACGGGTG
TCGCTGCGAAAGACCACCCCGATTACTTGAAGTTTTTTAAGCTGTTGAAGATGGGACTTCCTGCTGagcaagtgaagatgaaaaTGCAAGCGTCAGGCGT
TGATTCGTCCGTCCTTGATGACCCCGATGCGATTATTGGGGGTGCTGCTCCGGTCGCTGATAGCGCTTCAGCCCCACCTGCCTCTGGTAGTACCTCTGTg
aaggacgacgagcagtATGCGAAGTTTTTCAAGCTTCTGAAAATGGGAATGCCTCCTGAGCAAGTTAAGTTGAAAATGAGTGCGAGTGGCCTGAACCCAG
ACCTTCTCGACACGCCGGATGCGCTAATGCCTGGATCCAGCGCTGCCGCGCCAGTGACATCATCTAACCATGTCATGACTGTAAAGGAAGACCCGGCCTA
TGAAAAATTCTTCAAGCTGGTAAAGATGGGGATGCCTTCTGAGCAAGTAAAATTGAAGATGAGTGCCGCGGGCTTGAATGGAGATTTGCTAGACACACCT
GACGCCCCTTCTCCCAACCAGAAGGCGGGTGGTACTACCGGAGGCGGtggccttcttgctggattGCCTCCTCCGAAGGAAGCAGTGAAGGTGGACCCGT
CGGCCTTACAGGCCAGTTTGGCGTCAAAATTGGCCAAACCTGCTCCGAAGAAGCCGGAGGAGCCCCAACTCCCTAAGAAAGAGACTGTGAAGCCAAATGT
CGAGTTGCGTCCACTCTTCTGGACTCGCGTTCCAGTCAATGTAGTCAGCAGCACTGTatggatgaagctgaacgacTCGCATGCGGAGCTAGATGTGGAA
GAAATGGAGTGGATGTTCCGCAAAAACCCGGTGGATGCCTCGAAAAAGCTggatgagaagaagaaggaagctgAAAAAGTGCCAGCTCAGCCCAAGGAAG
TACTTCTCTTTGATCCGAAGAGGCAGCAGAACGTGTCGATCGCTATTGCCCGGTTTAAGATGTCGTCCGAAGATATCAAGAACGCTATATACGCTTTGGA
TGGCCAGAAACTGGGATCTGAAGTGCTGAACGTGTTAATTTCTATATCGCCGACCCTGGAAGAGATTGATATGCTAAAGAACTACGACGGagacgtgaag
ctgctgggaaACGTGGAGAAATTTTTCCTCGACTTGCTGACAATCCCGCGCTACACTCAGCGTATCAAGTGCTTTAGATACAAGTTACAGTTCGAGAATC
GTATCTTGGAGACGCAGGCGCAATTGGATACTCTGGTCGCTGCTACTGACCAAGTAACTGAGAGCGACAAGTTCCGTCGTGTCTTGGAGAATATCCTGGC
TATCGGTAACTACTTGAATGGCAGCACGCCGCGTGGTGGCGCCTACGGTTTCAAGCTTGACACTTTAATGAAACTTCACACGCTGAAGTCCGTTGATCCT
CGTGTCACATTGATGCACTTTTTGCTGCGCCAACTGGAAGAAAAGACCCCGGACGTCATTACttttgctggagaagttcctCACATCGTGGAGGCGAAGA
GATTATCTCTTGATCAGTTGCGTGCTGATCTTTCATCTTACAACACGGAGCTAGCTATGCTCAAGGGCCAAGTCCGTGCTTCAAAGAACGATCACATCGA
GGGTGACAAATTCTACGAGGTAATGACCCCATTTGCGAAggatgcagaagaagtgcTAGAGGAGCTGGGACGTGACTTTAACGGTCTGGAAACTTCATAC
CAAGAGCTGGTTAGCTCTTTTGGCGAAGATCCACGAAAGGTTGGCCCCATGGAGTTCTTTACTATTCTGGATGAGTTTGTGACCGAATTTAAGAAGGCGT
ACCGCCAAAATCAGACCAAGGAATACCAGGCAATTTACGAAGAGGCCGCCGCGgcccgtgctgctgctgaggcaGCGAAGGCTGAGCGGTTAAAACAGGA
AGCAGAGGAACGTCAGCGACTTGAAGAGGAGAGGCAGCAGAACTCGCAGGAGACCAAGGCGATTTATGCTGAGATTATGTCCATCATCACTACCTGGGCT
GGAAAGCATTCGCCTGGAAATGAAGATGCCGTTATGTACATGTTCAAGGACATCTCGCGGAAGTTTGGCATGGAGGAGATGACTGCCGATGATTTTTGTG
ACCGGGTGCGGCAGTGTGTTGGGTCGAAGTGTGCAAGCAAAATCATCCCGAACTCCGCGAAGCTGTTTtccgacgaggagaagcagaatACGCTGTTGGA
GGCCTTTGCCCGTTTCAAGGAGCAAGTCAAGAAAGAAAAAGAGTCGAAGAAGCAACAGCGCAACTCACTCGTTTCCCCACCTTCTGAAGGACGCGAGAGA
GCGGGATCCTCTTCGGCGGGTCGTAGGCGCAACAAAGTGGTGGTTCCGCTCCCCATAAAGGATATCGAGCCCGTGGTTGGAGAAGAGGCGCAGCTGCTCC
ATAAGTCCATTTTGGAGTCGGTGCTCGCAGCATTTGGGGGTGATccgaagaagatgaagtcgttcaCATCCCATACCCGCAAGTACGGCAACGAGCAGAT
CACGGCGCACGAGTTTTACCAGTATTTAATGGATTCCTTCGACCCCGACTTCGTTGGTCGTTTGGTGCCAGACCTCGCGCGTCTCTTACAGGATTCAGAG
AAGCGGCATGCGCTTATCCGCGCATTGTGTGAGAGCGCACCTGGCTGGGCAAAGTTTGCGGG