Description :
From Genome Similarity Track
Location :
scaffold_47:73941- 75687
Transcript NameFunction/comments
Plaha_PHALS_00494hypothetical protein

Sequence
1746 bases(100 bases per row)
gccttgaccttagcgggatccgctcgaaggccacgcttcccaataaaaaggaatctcttctgcgccaaagatgcacttgtctccattggcgtacagtttg
ttcgtgcgcatgcactcaagcaccgctcttgaatggacgatgtggttctcctcattcgtcctcccgtgctctgcacgactgtgaacgaaaatgtcgtcaa
agtatgtctgttcATACGCTCTGtcgggcctgaacaactgcgtcacaagacgattgaatgttgctggtgcatttgatagcccttggggcatcaccagcca
ctcccagagcataccgcttgGAGtgttcaccgctgtcagcggaatataacttgatcccatgagcaattggtaatacccatcgaccaagtcgagtgcactg
tacttcgtacatcccNNNNNNNNNNAATTGACTGCTAATCCTGCTTCAAAAGAGTGAAACGTAGCCTGTACTATCAGAACACAGTCCTCATTACTGACTG
AGGTAATAATGCTGTGAGCTTTCCGCAAATCGCCAATATTAAGAGCTTACTTGTCATTGCATAAATGTTGATGATCAATTCGTCATCACATGATGCTGCA
GACCTAGCTTGCACATGATACCCCGTTTAGAATGTGCGAACATATGAGCAGACATTAATCATGCAAGAAGGTGATGTTGGTATGACAGAGTGCATACACT
ATTATCGTGTGCGGTCACATTACGCTGTTGTTACTTTTAGTCGCTGTCCTGTCGATCTTTGATCGGTTGACTTTCGTCAAGTGGACAATTGTCTCGGTGA
CCCTTGTCCAGTTGATCTTTATCTGTCGACATTAGCCCCCCCCTCTGATTCTTCTCGTATGTCCCGGGGGTTCTCGTTCGGGCGCTATTGGCCTCTATAA
CGAGTGGTGTCAAACTTTGTCGTGGCGATATTGCCTTTTTTTCATCGTGTCGGCCTTAGTACCGGCAGTATCTTGGTAAGCAGATCTGCTATCTTGTTTG
CGGAGTTCACGTACTCGGGCATGATGTCTTTCTTTCTGTCTTAGTTGTAAATGATCTTGTCCCTTTTTTCGCTTCCTTGCGCTCGCAGAGATTTACTCTG
ACTCTAGCCATCAAATAAAAGCCTGGTTGTGCATCAGCAACTTCGTTGCCTTTACAAATTAGATTGATCCTCAAATGAATTTGCTTAGCCGAGTACGATG
CGTCCAACTTGCGACACCAAAGTGAGTTCAGCGTTCAAAAAACTGTTTTACTCTAATAAACTTCTCACATGTCCATTACGCAGCGGCGCCAACTATCGAT
ACAATATTTCTCATGTCTGCTTAACAGTCGCTCTTATCTACGATAAAGTCTGAGATACTTCCACATCTCTACCACTTAGGTTGATATTTCGTGTGATTTG
ACGCATGTCTTTAGCTCCCTCTGAGAAATTCGAAATCCTTCTTCATTTTTCCAGTCGAGCATCGTCGGCTGGTGTATCTTCTTAGTCGCCTTTTGCATTC
CGGCAGCGTGCATCCAGCAATCCAGAGAAAGCTAAAATAGGTTTTACCGTCAATTCCAGTAACACGTATTTTAATCGGTACCTTGGCGCTGTCGTCTGTA
TCAACGTTTTATTTTCGGATTGGCCACCTCGCTGCAATTGAAGTAACCAGTGCATATTGAAGCTCATCGGTAGCTCTTGGTTGACTTAATCTGTTATATA
TGTTAGAAATTCTAGATGCGCTTGTCGGGCGCCGTAGATACGATTC