Description :
From Genome Similarity Track
Location :
Scaffold_23:7392- 11257
Transcript NameFunction/comments
Albla_Nc14026910vacuolar protein sortingassociated protein putative

Sequence
3865 bases(100 bases per row)
TGTATGTTCCATTGATAGGATTACATCATCGACATTCTGAAGCAGTTTCAGATGAGGCTGTCTCACTACTGCAATTTTCCTACAAAAGCGATGAAGAGGG
AAATTCACTGGACCTGTTTCTTCGCCCAATCCGCATGATATATTACCATCAGCAGCTTTTGGAGCTGGCGGATTACTTTATTGAAGGAGTTTTGAAGCCG
TTTGGATTAGGCTCAGAGGATGTTTGGGTTGCAGCTTCTCAATTGTTATTGCATCGAGAACAAAGTTCTCTCCGATTGAGTGCTATCATGATTGAGCCTT
CCATCGTATTACCAATGCAATGGAACGTTGCACAACATATCGCAACCACAGCCGAGAAACTCACACTTCAGCACGATCAGAATGCAAGCATAGTGTTTGA
CCGGAGCTTGAAAGATGAGACTCGAGAAGCTCATCAAAGGTACCGCTTGGTATCGGAAGAAATACTTCCAGCCTCACCAGGACACACTGTAATGAGGACT
GACTTCAAGCAAGTCATTTTGAGCAATGTCAATGTGTTTTGTGTTGTCGATGGTGGAGAAACGTATCAACCGCTTTTCTCTCGTCCTATCCAGTCCACAG
TGGATGTCATTGACACGATGGATCAGCCTCAACCGGGTAGAGAATTGGCCAAGGAGATACCTCGATTCACCGTTTCCGCTCATGTTTACGAATGCAATCA
AGAAACGAGCAAAGACCCCATCACAATCGATTTGAACAGAGAACAGTATCTTACCCTTGTTGCAGTTTTCGAGAAGAATCTTGGCGCAGATGAGGCGATC
GCTGGCGATATACACTGGTCTAAAGACGACTCACGTCCTCAAGTCGAGTATTCGTATGCTCGGTCGGATGTCCAAGCGGTGACAATCACATTGGCGGTAT
GGATGACGAATCTTCGCTGCAGATTTGTGGATGCGTCTCAGGTACTAGAAACAGATGCAATCAGCATCTCGTTGGATGTGTTGACCGATCAAGATCCGAC
TCTGACATTGACGATAAAAGGCTTGAAACTCGGCAAGTCCAAAGACCAGCTGCTACTCATTTCGACGACTCCAACTCGACTGCTGTTGACGTGGAATTCG
GAGCTTCCCACCTCCACCGTGGCTGTTGATATTGCGAATGTGAAAGGATGGCTGGAGCCCGATCTATTACTCGAACTGATTGACTTTCTTGAGCTTCCGT
CAGTCAACTCTTTGAAGGATGAGCTGCAAGCTTGTTCAAACGCAACGGCTATACTACAGAGCAGTGAGCACGACGCACAGACTTGGGATATTACTCTTAT
TGCAAAAGAGATCTCGTGGATGCTTCCCAAAACTGAAATTGCAAGAGAATCCGTCCAACTCGCATGCAGTGCTGATATCGATGTACATTTGCTCTTTGAG
CCTTACGAGGAAGCAAAGTTGGAAGACTCTGATGGGTCTACAAAGATCGGTCGAGCTGTCTTGATCAAAGCCAAGTCGTTACAGTTCTACTCAATGAGTC
AAAGTCGTACTGATGGAACTTTTGGACACGGTAGAAATCTACAGATCCTGGAACCTTGTGACGTACAAATTGATATCAATGATGTCGCTCCTCACGAAGC
CCAAAAACAACTCATTGTATCGATTCAAGTGAGTCCGGTTCATGTGTATCTGTCCTACAAAGACTTTAGAAATATTTTATGGACCTACGAAAGCATCGCG
AAGACAGTTCACACGCACTTTGTCTCCAAGAATGAGAGAGAGAATGGTCATAATGCAACTCCAAATGTGCTTTCAACTGCTTTGATCACAGCTAAAGGCT
CAATTTCCGGGAATTCGGAGCTTATACAATGGCATCAACACTTTACGTTGGAGTGCACACACGTTGTTGTGACTGTGATCAACGACTGTGAGCATTGCGA
TATGGGTCTCGCTCAACTTTGTATCACAAATGGGAGCTTCTTTGCCAACATCAATGAACAACTGGAAGACTCCATGGTATCTGGCGCTCCTCAACGATTT
CTTACCATCTCTGGAGGAGGTAGCCTCACGACGCACCTCATGTATCTGAACCCGCAGATCGGCCGCTGGCATCCAATGTGTAGCCCTTGGCAGCTTGAAG
CCACATTTCAGGGCGTTCTTTATCAAGAAAGGTGTAGGAAAGACGCTCGGGATGGAAGAAGGAACGAAATGCATGTGCTTCTGAATGCGAATTCCCCACT
AAAAGTGATCGTCACACAAGATCTTATGGACCTTGTCGTTTCAGCTATGAGTGCATTCGAACGACAAAGGGACAACGATAAGTGTCTGTGTGACATTCCT
CATGAAATTGAGTCACAGAGTCCTCATCCTTCACGTTCCACGCAGCTTGATGCTCCCATTCTGCTTCGAAATATCACTGGATTGGAATTGAATGTTGCAA
TCAGTTCACAAGCTTCAAAGCTACTTCACGGAGACATTATGTGCGTGTGGCCTACCCACCAGCGAGGAAAAGGCTCTGGAGTCGTACGTCGACACGATGG
ACTGGATAGCTTGCGCTTAGACCTCTTGGATTTCGGCCAAGAAGCTCAATTCGAGCCGGTACTTGGCATCTCCTTGCAACGTCTCGGAAGTCAAGCTTTT
CCTATGGTCCCAAATTCTGGCGTCGATGCTAATTCAGCTTCACAGAACGGCTCATTTGTGGTGAATGTTACGACTCAATTGGTCGATGGGCGTTTATTTG
TCTCACTTTCGTCGTTGGTCAAGGTTGTCAACCAAACTACTCTGAGTATTCAAGTGTTGGTGCACTCTTCTTCATGGAAAGATCCTGTTATCCTCGGCAC
GATTGCGTCGAAAGACAGCCTGGCTATCCCTGTCATGCTTGCGTGGGCTAGTGAGCTTCGTGTTCGACCAGTATTCCCAGCGCCTCACACATTCGGATGG
AGTGCTCCAGTTCCGATTCAGACTCGATCTCGCTTGGAATTAGAGCTTGAGTCGAGTTGTGCGTGGGCATCGGCGTATTTCTGTGTGAGAATGGCCTTTA
AGCAATCCCTTCGTATCGTGACATTCCGATATCCCATTTCCGTCGTGAACAAACTCCCAGTGCCACTTCGATATAAAACTCGCAATGCTATGGCTACCGA
CAAGAGAATCGTCGATTCCTCAGTACTCAAAGACCGCGAAAATGAAGTGATTCCGGTCGGTGGAAGTAGTGGTGTCTGGTGGTGTACTGTCCATCAACGT
CCGCTTTTAAAACTGCTTATAAATGGATATTCGAGCACAAAATGGATGGAATGGCTGCAGAATCGAGTCAGAGGCGAAGAATCGATGCTTGAAATTGTAG
TTCCCCGTACGGATGGAGGCTCACTGAAGGTGTTGCTACAAATATCGGAGATCGGTCGATCGATTCAAATTTCCATTCTGTCACCAATTTGGATGATCAA
CCGGACAGGTTTGGACCTTGTGTATGGCTCCGAAATGGAAAGAGACTCCTATTTTCCCGGAATTGATGCACGATCTCGTTCGGGCAATGCTCAATTCTGC
GCGTTTGGATTGAATATGAGTGGCAAAGCTGCACCCAAATTTCGAATTGGTATTCCGAGCGCTGAATGTAGAGACAATGGAGTTATGTGGTCGGCGTTAT
TCGAAGCCGATCCCAAGTATCTCAACTGGCAAGATGAATGCCTTTCCATTCGTCTGTTACCCGATCGATCGGGATCCACTATGCTGTACGAATTTGGTAT
TTCCTCAGATGTCGCCACAAGCCACTTTGGATCGGTCACGACCTTGGTGAGCATTCTTCCACGCTTTCTGGTTCAGAATTTATCTCGACATACGATACTT
TTGACGGAATCAAACGCAGTGGGCGATGCTCATGCTCATTTGGCTACAGGAGCTGATCATATTAT