Description :
From Genome Similarity Track
Location :
Scaffold_1189:739- 9953
Transcript NameFunction/comments
Phypl_g12704hypothetical protein
Phypl_g12705hypothetical protein
Phypl_g12706hypothetical protein

Sequence
9214 bases(100 bases per row)
GAACCGGGCGGCAGAGCTGACAGAGGAGCTGAGAGTCTCCGATCTGGATCGCGACTCGGCTCTCCGCGGGCAGCACCGTGTGCAGACCATATTCttgcag
cagacgcacgaTCTCCGAGAGCTCGGGCATTACTGCAATGGTCTCCGCGGTGATatccagcatctccaagaCGAGCTAGCCACGCGCCCTCCTAGCGCCG
GTCCTCACGTGCGAGATTATCTCGCTCAACATCTTCAGCAAGTCACGGATCGCAGGGTCCGGGGTCTGGATGTGGAGCTCGGCAGTTTTGCTCGTCGGCG
AGACGATCTGGCTGCCAGCAACGACCACTTGGCCCAAGAGCTGGATCTGGCTGCTCAACAGATTTGTGACCTCCAGCAGGACCGATCCGCTGCGGATCGT
GATCGGGAAGATATCGAGTGTCAGTTCCAAGCTTCAGAGTCCAGTGTTTGCCATGTTCAAGAGACCTTGCAGCGCGCCGAAGCAGATCTGGCCACGggca
agcgccaccacctcAAGCCGACACTTCGGATCGCGTAGTCGCGCTGACGTCTTCTGACATGGCGTAACCTACGGCCGATCGGGATCGGGCCCAGACTCAG
TTTGAGGCGGCAGCCCACGATCTAGAGACCGCTCGTGGGATCATACGAAGCATCTCTGACAACGTAGCTCGGGAGCGCACTGCCCGAGCTGATGCCGGTC
GCCATGCGGACGAGCTCACAACGCAGAACTCGTCTCTTGGTACGTAAGcctgctcgatctccgtcCGAAGATTATCAACTAATTTTCCGATTCTCGTTTC
AGGTCAGGATCTCGATCAGGCTCGACAGTCCCTGGCTGAGCGGGATCGTCAATACGCTCTCGTCACAGGTCAGCAtatgctgctgcagcacgatctTGTG
GTGGTCCTTCGTGGGCGAGATGCACTTCGCCGCGAATATTCGGTGGCTCTCAGTAAGCTATCCATCGTATCCACTGCGCTTGGTGCGCCTCCCATGCGCA
CCGCGCTGGTCCTCGATGAGGCTCCCCCGGGTGACTCGATGCAGCCCGCAGATCGCGCGGAGTCCCACCAGGCGCCTCCTGAAGAACACCCCAACCAGGA
TCCACCTCCTGCTGAGACTGCAGATCCCGTTCCAGATCCGCTCCCTGCCGACGTTGTGGATCCGACTTCGGATCCCAACTCTTCCAAGCGATCGCGTCAA
GGATATTCGTCCCCGCCGCGCCGACCGGCCAaacgacctgctcgtcggaTCGAGGAGAAAGAAGGGGACGACTTCGACATGGGTGGCGCCTCGGCTGACG
AGGAAGGATCGTGCCAAGTCCTCAGATCCTCCAGCCGGGGATCCAGACAGCGACGGCCTTGGTGATATTCCGCGGTTCCTGAAAGACAACGTCGACGGCG
CCAagcttggtggtggcggctAAGATGCTGGCAGCGATGGGGGTGACGGCGAGAGTtccagcgaagacgacgatgccgaagGAGACGATGATGCCGATGA
AATGGCCGACATAGCGTCCGATCTGTACAAGGATCAGAAGCGTCTCGTCGTTATCCAGTCTCGATCGGCCGCGTGCCGTAAACGCTTGGCATATTCTCCC
GAActggacgacagcagcagtcaTCCCCCGTCCTCGCAACCACGCCGATCTCAGGTGGATCCGGCTGGGCGCTCAGATCGCCGCCgatctgctgcagtcc
gCCTGCCACCCAATGCGCCAACGCATCCCGTTGCCCCATTCGGGACTGAAAGTGTGTGCATCCCTAGCCGCACGCGGCCTCGTCCCTTGGTTTCCGCTGA
CATAGACCCTTAGTTGGCAGCGGAGTTGTCGGATCGAGCCTTGGTAACCATGACGATCGACGTGCTGTTCCCAATCCTCCCGTTCCATGCTGGGTGGATC
TTCCCTGAGGTATCGGAGGATCATGCCTCGCCCACATCGGCCGAGTTCTGTGAGGAGCTCATTACTGCAGACAACATTAAAGCTCTCATGGCAGCCGAGC
CTTGGCTAACGTTGCAGAATCCTGAGATCTGCATCAGCTTCGAGATCGACGTCGGTGGTCGCCTTGGGGCTTTTGTCGGTGGATACCAGGCGAACGAGGA
CACTGACGTGATCACTTACTGGTAGTCCACGCACTCGTTCCCGATCTCCAAGGCCCTCTGTATCAAGTTCCCGTGACTTCTGGTATTCCGCAAGCAACGC
AGCAACCGGCGATCTCACGCTGGCAATCGCTGGAAGAACGTCTTGCAGATATTGATCCAGGCGACGATCGAGGGCTGGTGTGATCTGGATCTTCTGCTGG
ATCATTTCCTCATGCATTTCCCGAAGAAAACGGACGATGTCGTCTCGTATCCAGGGATCGAAGCGCGTCGGGCGAACCTCGCCGATCCGCAGCTGCAACG
CGTCTAGCCGACCAGTCTGGTTGAAGCTCTAGTCGAGTGCGACGCGGCTGACCCATGGCGCAATCACTACCGCACTCGCCCCGATGATCATCCCGCGCGT
AATCTGACTCGAatcgtggacaagttctTCGGCGTCCGAGCCGCGTCCGCACCAACCGAGTGAGTCTGGATTGCGATCTGGTTCAAGTGAGATCTGATGG
CCCGTGGATACGTAGTCAGCAGCAATTTTGTCTTCGTCAGATCTCGTGACGTAACTTCATCATCAATATATCTTTTTCACGTAATCGTTTGTCACCTTTT
GATCTTCCACAATCCCTCTCTCTTCCTCTGGCGATCCTGCATCCATGTTCACACTAGGCGGTCTGCGGAGCGAGAAACCCTTCAGTCCTGTGATCTAGCG
GCCCCACCGCCTGATCGTCACATATGCATAACATGTAGCCCCTCCTTCGTTACCTGCAGCCTCCCTGCAAGTCCTTCAACCCTTTCTCAGTCAACATGGC
CAACCCACATCGCCGGATCGCCGCCTCACTACTCCTCGTGAGACTGCATCACGCTGAAACGGTTGTGATTCGCGCGATCCCGCAGTAACTCATGCAAAGC
ACCACAATTGAAATCTGCTTCATCAACCCAGCTTGGATCGTCATACCCTCGCCTGTGCACCAGAAACTCGCGGTAGATCCGACCATATCTCGTCCTCTTG
CCAGTCCTCATGTCTGtgaccttctccacctcgtacTCGTCTGCTTCTAGATCCGGGATCCAGCTATCCTCAGGTAACAACACCTCGTCAAAGTCCAAGC
GATCTGTCTCTTCCACCGCCAATCGGATCTGCGGCCGATCGGGGAAGGCTctcacgagcttcagcttggagACGTGTACGACTGGGATTATCCGGTACTC
TAATCCCGCGATCTCGAGTTTCACCGCATACTCACTGACCTTCTCTGCCACGCGGAAGGGACCGTGTCACAGGTGAGCTAGTTTCCGAGCATAGCCACTT
TTACTCGATCCGAATAGAGCCACACACGAGATCCAACTTCTTTTTGGTGTGGCTAGATCTCCTCGTTGTGTCGATCTGCCCGTCCGGCGATCGCCTCTCG
CAGACGCTGATTGACCTGCTCACGGGCTTGCTGATAATATCGCTGGATCTGGTAACGCCATCGCCGTGGATCTCGATGTGTCCGTCGCGTACTTCCAACC
GGGATCGTAGCTTCGAGAGTGGATCTCGGATCCCACTCGTGCACCAAGTAGAACGGGGTGTCGCCGCGGATCCTATCCTGCGCCGTGTTGATTGGAAAGG
TAAGTCGCTCGGCATACTCGTCCCAGTCTCGTTGATCTAGATCCTGGATATACATCTTCAGCGCCCTGGTGATAGTCTGCACCATGCGTTCCGCTGTTCC
GTTAGCCTGTGGTCGATACGCCATCGTTGCCCGCTGGCGTTGACCCAAGATCTTATTGAACGCGCGGAATAAATCAGACATAAAACCAGGCTCGCGATCA
TGTCGGGCCGCCTCGCTCGCTCCAAATCATCGGAAGACACACTCTCCATAAGATTCCGCAATTGTCTGGGCTGTCCTGGACGAGCTATCCTTCGCGATCA
CGTACCCGGTGAAGAGGTCCACCCAGATCAACAACTCAGTATTGCCTTTATAAGACTTCGGTAACGAGGGAATGGGATCCATCGCGATGATCTGGAACGG
GTACGTCGCTTGGATGTTTCCTGGCGCCTCTCCTTGGATCCGTGGTCCCCCTTGCCGGTCTCACAGTCGACACATTATCCCACGCACTACTGCACGCTTC
GATAGAGACCTCTCCAGTGATGTGATCCCGGATCCGCTGATAGGTACGGCCAATCCCTTGGTGCCCTCCTTCCAGACTCGCGTGATAATGATGTAGAATG
TATCGATGTAACGTctcaagtgcagcgagccTCATCAGTCCGTCGCGATCTGCATCAGAACATTTCGTAGGCGAGCAATAGAAAAGTAGATCATTTAGAT
CCACTTCATAATCCACCGCAACGTTGCTATAGGATCtagcttcttcttgcgtTAGATCGCATACGTCACCCGCCAAATACTTCTTCAACCCTGAGATCCG
CGCCTCCTCATCCGGATTTGTTCCACCCGGAGATTCCTAACGAACTCTTCCTGCAGGACATTTGGGCTGGATATCGATCGAGTGTCGGATCTAGTCATCA
CTGGCGCGATCCGGGCCACTAGATCTTCAGATCGAGTGATGAGCACTTCATCTAGGCGGTTCAGCGTAATCAGATCTTGTCACTcagcttcgtcctcgac
cACAATCCGGCTTCTCGgtcgagcgccgcgctggccaaACTGTCTGCACTACCATTCCTGTCTCTCTTCACATGCACCAAGTCGTAATCGGGCCACTTCC
TCAGCCTTTCCAGTACCTTCTGCTTCAATAATACCAACCCCGGGGCCTTGCAATCGATCTCTCCACGGACCTGGCGGACCACCAAGTTCGAGTCTCCGCA
GATCACGAGTCGTTTTCGGCCTACACCTTCCAGTAGGTCCAGAGACAGCAAGAGTTCATGGTACTCTGCCTCATTGACCGCCATGCTCGTTGCATAACCC
GATCTGGCCTTTACTACCGTCCATCCAGGAAGGCGCCACAAGATCACACTGTAtgcacctcctcctcgtttGACACGGGCCGATCCGTCAAAACTTACAA
CGTAAAGCTCTTCGTCGGCCCGCACGGTAGGAACAGGCGCCTGGATCTGGCGTTTCGGCTCCTCCTTCGGCGCGATCGAGATCAGGGCCTTGTCGACCTC
GGATCTGGGCGTTATTCTAGCGGCAAGCGCCCCTAGGATCTCGTCCTGTCCCTTCGAACACTTCGCGATATCGAGCGTCCATGGCGACAATAAGGCAGCC
CACTGTCCCAACCGGCCTTGGAGTCCAGCAGAACGGAACAGCCAGGCCAACGTTGAATATCGGGTCAGGATCCGGATCGAACGTCTAACCAACATATTGT
AGTTGATATCTAGGACCcgcaacagcgccagcacttCCTTTTCCACGATTCCGTATTTGAGTTTGTTCGACTTGAGTGTTCGGCTGACGAAAGTCACGAG
GTAATACATCTTCTCATACTCCTGCATCAATGCCGCTGAGATCGCCCATTCGTTCGCATACACCACTACTACGGTCTCTCGATCCGGATCGAAATAGCGT
AAGATCGGTGTCGTAGCtaccttctccttcagcttcgaaAATGCCCGGTGGGCATGGATCCAACGTGGATTGATACCACCAGTGGTCAACATCACTAGAT
CCATCGTTTCCTGTTTAACAGTCATTAGATCCGTGGATCCAGAATCGGGATCCGACTTGTCCGGATCCGATTTCCCGAGATCGATAGGATCTGACCCGGG
ATCGCGATCCGACTTGTCTGGATCCGACTTCTCAAGATCGAGGAACTCTTTCAGCTAGCCACGGGATCCTGTCATGGACATCGCAGCGAAGTCCACTTCT
CGCAACTCGTACAGTACTGCAGCATAAACTGCGTAATCTTCGATGAATTGACTGTAGTAATTCAGACTACCCAGGAACGACTGCATGGCTCGGAGCGATC
CCGGGAAAGCCAAATCCGTCAGGGCTGACAGATCCTTGGGGTTCGTCTTCAATTCGGCTTTCGATAGTCGATGTCCTAGATAGTCCACCTTGCTCATTCC
CCAGAAGCTCTTCACAACACTGATCGACAGGTTCCACTTGTCGCACGCTTCCAGCAAGTCTTCCACTCGATCACACAATTGATCCCACGATCTCGCCGGG
ATCAGGATATCATCAATGTAAGATCGGCGCCCCAGGACCGACGGTTTGCCTAAATCCTCTGGTTCTCCACCTTCAAACAGATCAACCTGCCTTTCGTCTT
GCCCATATCGCGAGATCCGGGTAAACCCGTACAAGGCATTGTCGACCAGTCTCTGGTAGATCTGCGGAGCGTTCTTGAGGCCGAAAGGCATCCGATTCCA
CTCGAACAAACCAAACGGGGTGATGAAAGCCGAGATCGAACAAGCTCGATCCGTCATCGTCACCACCCAGAACCCACTCGCCATATCCAGCGAATAGTCT
TGTCGAGATCCTCCAGCAGATCATTGATCAGCGGCATCGGGCAGACCATCAATGGAGTTAGGCCATTCACCAATCGATAATCAATACACAGTCGTATGTC
GACACCATTCTTCTTGATGATGATAACGATCGGCGATGCCCATGAAGAGGTCGAGTGGCGGATGGTCTTGGCTCGTAGCAGTCCCTTGATCAGATCCGAC
AGTTTCTCGCGAAACTGTGGAGCTACCTTGCGCACTCGCTGGGCGATCGGTTTCGCGTTGCCCACATCGATGTCACAGACAACACCCCTTGCCGCGGGCG
GCAATGCGTTGCCCTTACCGATGAGGAGGTGCTTGTATCGCCAGATCTTCCGATGTAGATGGCCGATCTCAGCTGGCGAGTTGTCCGACGGATCTCCCAC
TTGAATGTCTTCGATCGTTACCTCGTCGGTTGTTGAGGCGACCTCTGGCAGCACCGCCAACTCGTCTCGGACGTCTTCTGCGTGCAGACCACCCCCTTCG
TGGTAACATACCTGCTCATCCTCGACGGGTTCTTTCCCCACATTGAAATCTTGACCCGATAGCGCTACTTGATTTTCCCCATCTCGACCCAGATCCCGGT
CCCGTCTCCGCTCACCATCCGATAGATCAGCATTCCGATCTGATGACGCCACCTGATTTTCCCGATCTCGACCTGGATCCTCGTCCCGTCTCTGGTCAAC
ATCTGTTGAGTCCAGGGATGAGCTGACCCGATCTGCTGATCTTCGTCCTGTCTCTTGTGCGTTGGTATCCGGTGCGTCTTTTGATGACGCCCCCTTTACC
GTCGCGGCCAAGGCCGTCGGATCTCGGTCGTCCGGCATGGGATTTCGGTCTCGAGGTGGCCCGCTGGCTCCTGGACGTTCTTGATTACCTGGATCTGGCG
CTTGGGCGCCTTCGCCTCGCAACTCTGACTGTTTGGGATATAGAATACCTTCGGCAGCAGTTTCCCTCGTCTCCGCGGTCGTCACACACATGATCCGCAA
CGGCCGTAGCTCTTCACCATCGAGACTGTCGGGATGTTGCGACGCTTCCGGCGACATTTCGTCCTGGCTACCCCCTCTGTCGCACGATCCAGCTACCATA
TGCCAGATCCGGGCCGGTTCGCCCCGCCGGAGTATTCCACGCGGTGTCGGGTACTTGGGGCGGTCGACTGCTGGCCCGAGCGGGGCCTGCAGAGGCTCCG
CCTTCGCGGATCCGGCCTCGATGGTGGCCTGCAGAGCGAGGTTCTGTCACTCCATATAGCGGCGAGATCCCACCGACACGAAGCCTGGAAGCCTTGGTAC
GCGATCTCCTGCCAGCCCCATGCCAACTCTCTCATCGCTTTGCAGGATCAACTTCTTTTCACTGAGGTTGGTGGTCTGCATGTACCGTGTTCTGCCAGGC
CCCTTGATCAGCGTCGGGATCCAGCGGTCTCCGCGAGTAACCCACAACTTGTCTTGTCCCGATGCCTTCAGGCGCAGCGATAGCTCCACGGATTCCCCGA
TCTGGATCTGCATGTGCTGACCCAGCCTCAAGAGTTTCGCCTTGTCATtgtggagctgtcgccgtccGCTGAGCTGGATCTTGACCTCGTCGGGCAAGGA
GATGGATCCATCCGCGAGATCCAGCCGGATTCTCGCCGGAACCATGAAGTCCATACCCAGTATGGCTTCCTGACCCGATAGCTCGCCCACCCAGGTATCG
AAGAAATACACCAGCGATCCTGCTAAGGTAACCTTGATCCCAGTTCTTCCTTCCGTCGAATACACGTTCTCACCAATCCCAACACATTCTTAGCTCTGAC
TCCTGTCGACATAGCATCCAACCTTACGAGCAAAGGTAGTGTCCACGATGGACACTTCGGCGCCGGTATCTAAGCGTAAGACCGCCTTCCCATTGTTGAT
CTTGCCGGTGATCTTGGCCTGTCGAAACCACTTACCCGATGCATGATGTTTCCAATACCCTCGCGACTCTCCTGGCAGGAGATCTGAAGatactgcagca
ccaggttgGCGATATTTGTCGACTCGACGAAGATCTGGTGTGATCTCGCCTTCCGTTAGCCTAAACTATTGATCTGGATCTTACTGCTTCCAGTAGCCCT
GGCGGGCGACTGGATCAAGATCCACGACCACTGCACTGTCGGATCGAGAGAAGTCATCGGCTTGATAAATACTCGAGATCACAGCAGTACGTTTCCCAAG
CAGTTCACATGTATTACCGCGTAGATCTGGTAGCTTGCTAACTTGGTCTAACGGCGTCTTGTTCATGAATGCAAAGATGCAATACCTAGAACGCTCGGCT
CGTATCGGATTCCAACCCGACGAGCGTCCTAGTTTAACATCTTCTCAGCAATAGCAGGCAACATGCCCGCGTGCTTCGTTGGATTGTACCATTGACGGAT
CTGGTTGTAAAACTCTTCCGTCGGGCATTTCCCCATGTGGTGAAGTTCTCCACATCCGCGGCACACGGAGAGGCAGTGATCGGCCGGATGGCCTCTCTTG
CCGCACTTCTCGCACGTCAAGCGCCTCCAACATCGGAGATCCGTGTGTTTACGGGATCCGCAATGCGTACAGCGGCTACGATCAGGTCCATCAGGTTGGT
TCCGAGGACGGTGATCGCGCGGAGCTTGATCCGTCGCGTGCAGGTCCCCTTGGTTCCGATCCCCGCTGTTCGTGTTTTCTCGAGCTTGCAGTGCATGATC
GTTGCTACCAGCGA