Description :
From Genome Similarity Track
Location :
Scaffold_1663:739- 2458
Transcript NameFunction/comments
Phymu_g13526hypothetical protein PHYSODRAFT_508709

Sequence
1719 bases(100 bases per row)
CGAGCCGTCAACAACCAAGACCTCGACGTTCCCAAACGCCTTTCCTTTGTCAGTGGAGCCTCACAACCGAAAGACTTGGAAGACGGGAGCTACGTCCGAG
TCAAAACTCCCGACCAAATACCGATCGGTGCTCGCCCCATTGAAGGTGAAAATGGTGCCATCCGTGAAGGAGGAATGCCCGTACTCACCAGTAAAGAGAA
CCTCGGGCTGCTCTTCGAGTACGCAGCAGTTGGTCTGGTCTACGGCCTCCTACCGGAAACCATCTACCCGTTCATGCAGGAATACCTCAACTGTTCCGGT
TCTCAAGTCACAGCCGCCAGTCAGTTGGTGGTGCTACCGTGGAGTTTCAAGGTTTTCTACGGTATTTTATCCGACTGCCGTCCGATCTGCGGCTACCGTC
GTCGACCGTACATGCTCATTGGCTGGgggatctgcttcatcatgTTGTTGGTCATGTGCGTCATGCCTATCGGAAAGCCTTACTTCACGGACGCTACGGA
TCGAGACGTTGATGTGGATGACTACACGCCGGAGATTGAAGCGCGTATCAACTATGACGCTCCCTCGGAAGGCGCTAAGTACGTCATGTTGATGTTCTTT
GCGGCGTTCGGTTACGTCATGTCGGACGTGTGCGCCGATAGTATCACGTGTGAATTGGCACAGCGCGAGCCACTGGAGAAACGAGGCAAGACCCAGTCGG
CCATCTACACGGTTCGCACTGTGATGGTCATTTTCGGCGAGCTGCTGACTggattcttcttcaatgGCGAAGATTACGGCGGCACCTTCAACTTCTCTCT
CAGTTTCCCGCAACTGATGATCATTGTGACGGTGCTCACACTCCCAGTGTTCCCTATGACGTGGTTCTTCATTAAGGAGGAGAAAGTGGAGCCTGCTGAC
TTCAAGGGGTAtatgagcagcttctgggaTTTATTGTGTACTCGCGCAGTGTACCAAGTGATCGCGTACAATTTCTTCGCCAATATCTTCGCGGATATCA
CGTACACCGGCAGTTCTCCTATCCAAGATTACATGGTAGGGGTTACCCCCATCAATAGTACACTGAGTGACATTCTCAGCAATCTATTGTTCATGTTTGG
CATCATGATCACGTCCAAATGGGGGCTacactggaactggcgctggatgatTGTGGTCACGGGCGCTGTGGTGATCATTGTGGACTGTACCGTGACGATG
ATCGTAGTATGGGACGTGTTCCGTAACCAGTGGTTCTGGTTGGGTCCTCCTATTGCCGTACAGCTCCCGTACGGTGTGGGTTGGATCATTTCCACTTTCG
TGACGGTCGAATTGGCTGGACTCGGCAACGAAGCTGCTGTATACGGGTTAATTACTACAGTGACCAACGTCGCGTCCCCCTTCGCTTCGGCTTTGACTCT
GGTGATCGATGCTCCGTTCAACATCACGAACGCTCGGGTgcaggaagacgattacACGATTCGTCGAGATCTCACGTACACTATCGCCATTATGTATGCC
ATGACGGCCTTCGCGTGGGTCTTTCTGTTCCTGCTGCCCAAGCAAAAGGAAGACACGCAGCGACTTCTGCGCAAAGGAGGCAAGAGCAAACTCATCGGCG
GGATCACAGTCTTCTACTTGTGTTTTGCGATGGTGTGGTCTGTCATGACCAACATCATGGCTATCTTTACTAGCACCGCGTGTCTTGTCATCGCTGGGGG
ATCTGGTTGCTAAGTGCAT