Description :
From Genome Similarity Track
Location :
scaffold_53:7387- 8650
Transcript NameFunction/comments
Pl_111009hypothetical protein PHYSODRAFT_524864

Sequence
1263 bases(100 bases per row)
TCACAGTGTTTGATGTGGCAGCAGTAGAACCTGGTGGCGGTGAACGACCATCGCAAGCCATCCATTGATCTGAGCAAGTGAGCACTGAAATGCCGCCCGT
GTCGTCTCCAACTACAAGTGCTTCACGATCATCTGAAGGTTTTTCAACGTAAGCAAGACACAAGGGAATGCTCTGTCGTCGCGAGTAATCCACTAGGTCA
CCGATAAGCTGTCCTGAACTCAGGTCGTAGAAACTCAAGGTGCGATTCATGGATGACACAGCAAGACGGTTAGAACGCTTCATCACACAACAGTCTGTGA
GCCAATCTCGACCTGAAGTTAAAACCTGCTGCGGGGCTAGCGAATTCGCGCTCCAGGTTCGTACACTTCCATCCTTGCTTGTTGTGAGGTAGACACTTGG
TCGTTCTAACCGTACAACTCGAGTGATCACGTCCTTGTGGTGTGGTAGCAGACCAAAACCGAGCATTCCACCACTGCCTCCTGTGACGTTGCCTATTATT
TCGGTCGGAATCACTGATCCAGAGCCACTAGGACCATTGCAATTACCGATCTCACCCGTGTATTTTTCAGGATACGCCGTATCATAACATGAATTCCCAT
CATCTCCAGTATATTCGTCATTGCCGCTGCCACTGAGGAACATATACTACGAACACATCAGCGTCCGGTTAGAAGGGGGGCTACACGAAAAACGGAATTA
ATTGCAACGTACATTGGTGAGTTCATCCCAATCCACAGTCCCATCGGAGTTCGCATCGATCTTTTGAAATCTGGGATCACGAAAAGTTAGCATCAGTCGT
AGTGATCAGTGACACCGTCAAAGCAAGTGAACTCCGTACAATTCCGTAAGCTGCGTTTCGCTGAGCGAAGCGTCTACAATCTCGCGGAAGAGACTCACGA
ACTCCTTCTCGGTTAAGTCGCCATCAGCAAACTTCTCCTTGAGTGACTGTAGCTGCTCGACACCAATTTCATCACGAGAAAAGACTGTGCCCGACCGCTT
TTTCGCTCGAGGCAACGCCATATCGTTCGCGATTTAACGAGCTATTGGTGTCCGTCCCATGGTCCGACGAAAATACTGAAGACCGAAACCGAAGTCTTCC
ATCACATCTCGATGCTAGCTGTTTCTCCGAGTGTATGACTCTACATCCGATTTCTTGCATGTGCACAGGATCCATTGCTGAAAAGTAAAACCTTTCGCGT
CGCATTGGTTGTTTTGTGTATGGCCACTTGTCACCATCTGCGTAGACCGAACATCGCTGTTTG