Description :
From Genome Similarity Track
Location :
Scaffold_74:73847- 77632
Sequence
3785 bases(100 bases per row)
TCTCGTAAGCTAACTTCCTCTAGCGCAAGGTGCTGTGTAACCCCGTCACACTTGGTAGCACTTGTAGTCAATCAACGCCACCGCAGGTTGACTACCTGAA
CCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACATCTCCCGTATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCAGGATGGA
GGCTCTGCAGAGCCTGGTGATGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAATGCATTTGACGCGTACGAGCAGGGGCTCATCGCGCATAAGCGGGAG
AACCTGCAGGCCCTGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGTTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAGCCATGACG
TTTGGGTCCGAGAAGTGGAGCTCGCAATGGATGCGACTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACCCCCCAACCTTAGCAGCCGTGCTAC
GTGTTGGGTGTACACACGGGAGGCAACATCCCCTGGATGTTTCACATCCTGGACTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTAC
GAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGCAAACAAGGGAGGCGTGAGCTGCACGAGTACGTGCAAGAGATACGGGAGCTCACGCGTCCATAGTGGG
AAACCAACTTAACGAACACATCAAGATGACTGTGTTCATGGACGGCATTCGAGTGGGCCCCGCACGCACTCGGCTGTTCCGGGTGCAGTCAAACACCCTT
GAAGAGGCGATTCAAGTTGCTCTCTAAGAAGAGTACAGTCATCGCTAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGCGTTCCTTGTCGACTCCCGGTC
GAACGAGCCCCAACAGACCAGTTCCCATGGTACCCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGATGATGTGCCACTTCAAGCGCGA
CAGTTCCGCGGAGAGGCTCCGCAGACGGTCTTTCCCCAAGCCCGTCCACAAGGGTCGCTGACAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGAAAC
CAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGGCTTCGCAC
TCTCGAATCGGCGAAGAGCAGTAGCGGGTTGCTCATAGTACACGGATGTGTACGGGGATACGATCTTCCCTGTAGAATCTTGATCGATTCTGGGGCGTGG
ATGAAATTCGCACCCCGCCAGACGGTTGCTCGTAATAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGG
TGACGGGAAGGTCGTCACTGTCCCTAACGTCCAAGTGGATCTGGTAGTCAAGTTTGAAGAATTTGACAGCCTTGAACAGTTTACTGTTCTCGACATGGAT
TCTTACAATAGGATCTTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGTATCGACTGGCGAGGTAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCG
ACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCTGCAAGGGCTGCCAGGGTACCAAAGCAATCGGCAGATGCTTGGGGGTCGT
CGACGTATATGACGGATCCGAGGATGCATTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACTTAGTT
CCGCAGACAGATGCAGCTGTCACGAACACTGACAACAGCGTGTTCGGAGTGGGTAACAGAGTTCCACACACGGTCGCCCAGACCTTAACTGAAGAGGAGG
ACGTCGGATACGCTTCCTGTGTGGGTAACAGAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGCGGAAGGTGTCGGACACGCTTCCTGTGTGGGTAC
CACCGTACCACACGAGGCCACGAGTGCCTCGGATGTCAGAGCGCCGACATCCCCAGACGTGGGCAGCAAAGCTCCACGTCACGGTCGCCGTCGACGACGA
CGCCGACGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGG
TGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTATCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAA
CCTCGAGGAAATGACGGTCGAGTCTTTCCTGGCCAGCCGCAAGGCTGGGAAAGTTGCCGAGATGGTGCTCATACGACCAGAGGCCACTCGGGAGGGGTTA
AACGCCTCCTCTGTCTTGGACGAGGACGTCCTAGAAGAGCTGTGCAAGCAGCGTCAGACGCGCTTGGGTTCTGCGATCCTTAAGAACTCCAAGAATCCGG
TGTATCTTTTGGTGACGGAGTATGCGGACATGGTGAACAAACATCCACCGACCCAACTCCTACCAGATCGAGGCATACGGCATGAGATTGATCTCTTGCC
TGACACAAGGTACTGTGTCACGAGGCAATGGCCTCTTCTGCGCGACCAGTGCGAGCTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTG
CGGGAGTTGAAATCCCCGCACTCGACGCCAACTTTCTGCGTTCGGAAGCCGAACGGAAAGGGGCTTCTAGTTCACGCTTATAACAAGCTGAACAACGCAG
CGGTGCCGGTCCAAACATTAACCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGTAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTA
CCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAAC
GCCCCGACGACGCTCAATCGCCTGGTGACGCAACTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCG
AGGGAGGCAAGACAGTCATGGAGATGCATCTAGGACACCTCCGTCGAGTGTTGAACGTAATGCGAGCGAACAAGCTCTACGCCAACATCAACAAGTGCGT
TTTCGCGCCACCAGAAATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGAGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATTGCAGCATGACCAACG
CCCCGATCTTAGAAGGATCTCCTAAAGTGGTTGGGCTTGGCTAACTACCTTCACAAGTACAGTGCAGGGTACGCGGGCTTTGCTAAGCCCCTGTCGGGCC
TCCTTCAGAACGAATTCGACTGGTACTGGGAGCGAAAGCACCAGGATGCCTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGTC
GGACGAGACGAAGCCGTTTAGAGTCGTCTGCGATGCCTCCGACTACGCCATCGGGTGTGCGTTGCTGCAGACCGACACGGCTGGACATAAACGAGTCATC
TCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCTGTCCACGACAAGGAGCTCATAACAATGACATATGCCCTTGTGAAGTTTCGTGTTC
ACCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAG