Description :
From Genome Similarity Track
Location :
Scaffold_325:7384- 12751
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_325-snap-gene-0.6Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_325-snap-gene-0.9Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_325-fgenesh-gene-0.1CDC5 protein
Pytar_ATCC12531maker-par_contig_325-fgenesh-gene-0.4Conserved gene of unknown function

Sequence
5367 bases(100 bases per row)
CCGCGCTTCCGGAACAACTATGTGCGTTACCTGCAGTGGCTCTCCACCGCTGTCGTCTTCTGCCACGCGCTCGCCATGGGCGTGATCCTGCTGCTTGTGG
ACCAGTTCGCGAGTCAGCACAACGCCTCCGTCGCCCCATGTTACTTTCTCGGCTTTCTCAACGCACTGCTCTTCCCTCATCGCTCGGGATTCCGCGTGAG
ATTTGTGTACGCGACCGCCGGGACGGTCGGTGTCGCCGTGCTGTTCGTGGCTGCTGGGCTGGCTCTCCACAATGCCAAGGTCCCGACCTATGCGAGCTAC
ATGGCGTTGACCAATATATTAGGCATGATGATCAGCCACGAAGAAGAGTCGCTGCGCCGCATCTTCTTTGTGCGCATGATGCTTCGCTCGGACGAGTTCC
GGCGGCGGCACGACGCCATTCTCACGCTCGAGTCATGGTTCAAGGCGAGAATCCGCCGCCGCCGTCGACGGCAGCAAGAGGAACAAGGGGTAACAGTACA
CAGTGGACAAATGTATTCGCCATCGCTCAAGATCCCCACGGTCAACCAAATGGCCCACGCCAGTAAAGTGGGGATGTCGCTTGAACTAGGACGTGCTGCG
ATCGCGCTTCTTACGGAACTGGTGTGAGTCATGGAACGTTAGGGAATGTCCTGGACAAAGTACACGAGACGAGAGTTTTCAGTCACACGAAGAGAAAAAG
GCTGGCAGGAGTCTTCACCTCAGTCGTGTCGCCGGGTCTGGCGATTTTATGAACCAAAGCACACGGCGCCGCCAGCAGCTGGAGCGCTCTGGCGTGGTAA
AACGTATTGGAACGCACGATCTCTATCAGGATTTTCTGCGATAACAATAGTAAAATGAGTCTCCTGGGTAGGCTTCTCGTTCTCCGTTGTATACCTTCAT
CNNNNNNNNNNGTTCAGGATTTTCTGCGATATCAATAGTAAAATGGGTCTCCTGGGTAGGCTGCCCTTTCTCCGTTGTATACCTTCATCTTGGCCGTCCG
AAACTGCTCAAACTTGCGCATGTGGTGATCAATGAGGCTGTTCACGTTCTCCACGCGACGCCTTTGGTCCGAGAGCATGCGTGCTTTCTTTTCCTTTTCC
CTTGCGGAGCCGCTCCGCTAAGAGGAAACACAAATGAGCGCTAGCCGTGAGTCGGCGCCTTCAGTAACGAAATCAACAACTCACACTCTTCTCGTCGAAT
TCCTTCTGCAATTTCTGCTCAATCTTGATGGCCTTTTCGCGGTCATCTAGCAACCGCTACGCAGACACCAACCACCCAGGTGAGCGAACTATGTGCCGAC
CAGCTACTGATTCGATGCCTCACCTTCATGGGCACGATGCCCCAGTCTTGGATCTGCGCGAGCACCTGGAGGATCTCCGGCTCAGCGCGCTGCATCATCG
TGTCGTGGGTCTCGCTCGCTAGCTTTGCGCTGCTGCTGCCGAGACTCTGGAGACTCTGGGCGATGGTCTTGTTGTCTTCCTGCGCGGCAACGTCCTGCAA
AGTCTTCGCAAACACGCCGAGAAACGCCTCCTCCTCCTCGCGTATGTGGAGCATCTTGGCCACGAGCTCCTCCAGCGCGCGTCCGTTGCGCTCCATGAAC
TGCAGCTGCGCCGTGAGCTGCCTCCCGCGCTCGTCCATCGTCGGTGATCTCTCGATCTTTTGGAGCTTGGGGAGAATGTCTGCGACGTGTGCAGGAAAAA
AATTCGAAAGGGTATTCGGGTTATCAAACCCGTTTGAAACTTTCACCGAACCCATATCTTGCTAAACCCATATTTCATCTAATTATGCCCCCTCCCTGGT
AGGCTACACTATTCCCGTACTCACAGTACCGCCTCCCTCCATTTTCGTGCTTGGCTGCCCAACAACCATAAAGAGCCATAGAGAGAGAGCGCGAGAGGAA
GACCTCTCTGGGTTAACTCGACGGCGCAGCCATGCGGATCATGATCAAGGGCGGCGTGTGGAAGAACACGGAGGACGAGATCCTCAAGGCGGCCGTCATG
AAGTACGGCATGAACCAGTGGGCGCGCGTCGCGTCGCTGCTCTCGCGCAAGTCGGCCAAGCAGTGCAAAGCGCGATGGTACGAGTGGCTCGACCCGTCCA
TTAAGAAGACCGAATGGTCCCGCGAAGAAGAAGAGAAGCTGCTCCATCTCGCCAAGCTCATGCCCGCGCAGTGGCGCACGATCGCGCCGATCGTCGGGCG
CACGGCCGCGCAGTGCATGGAGCACTATGAGCGCCTGCTGGACGCGGCCCAGCACCAGCAAGGCGACGGCGTGGACGGTCAGGGCGCCACGAGCGACGAC
CCGAGACGACTGCGCCCGGGCGAGATCGATCCGAATCCAGAGAACAAGCCGGCGCGGCCCGACCCCGTGGACATGGACGAGGACGAGAAGGAAATGCTCT
CGGAGGCACGCGCGCGTCTGGCCAACACCAAGGGCAAGAAGGCCAAGCGCAAGGCCCGCGAGAAGCAGCTCGACGAGGCGCGCCGCATGGCCGCGCTGCA
GAAGCGCCGCGAGCTCAAGGCCGCTGGGCTCACGAGCCGCGTGCAGCACCTCAAGAAGCGCAAGTTTATCGACTATGCGAACGAGATCCCGTTCCAAAAG
GACGTGCCGGCAGGCTTTTTCGACGTGTCGGACGAGCGGCTGCTCTCCAAGCGCAGCACGCTGGACCCGAAGCAGGTTGCGCTGCAGCTCGACAAGCTGG
AGGGGCGGCGCCGCGACGACCAGGAAGAGAAAATGCGCAAGCAAGACGCCAAGCGGCAGAAGACGCTCATGAAAGCCGACCTGCCGCAGGCCATTGCCTC
GATCAATGAGAAGAACGACCCGATCAACGCCATCAAGCGCAAGCCGCTGCAGCTGCCGGCGCCCGTCGTGTCGAACGACGAGCTCACGGATCTCGCGAAA
CTCGGCATGTCGGCCGCGCACGCTGCGGCGCTCGCCCTGGAAGGTTCCGATGGCACGACGACGCGAGCGTTGATGGGCGACTACAGTGCCACGCCATTAC
CACGCGGCACCATGACGACGGCCAGCCAGTCGCGCGATCTCCACGATTCGATCATGCAAGAAGCCGCCAACTTGGCAGCCATGTCCCGAGCCGCAACACC
GCTGTTGGGCGGCGAAAATATTCAGCTGCAGCAAGGCACGGGATATGCCGGCGCGACGCCGATGCGCACGCCGGCAAGGGACACGCCCTTGTCTTCCTCG
TCTGCGTCTGTGGCCTCGTCGTCTCTGCGCACACCGCTGCGTGATGAGCTGGGGATCAACCCTGAGCAGTTGTTCGGCATGGAAACGAGTGCGCGTGCTG
AGAAGGCCCGTGCCAAGCGAGTCAAGTCGGACCTCGTTGCCGGGCTGCAGAGTCTACCGGCGCCGCAGAACGAGTACGAAGTCAGCGTGCCGCTCAAGGA
AGATGGTGACGACGCAGACGGCGGCCGTGCGCCGCTTGAGGAAGACGCCGGCGACCGAGAGGCACGCTTGGAGGCGTACCGCGAGCGGCAGCGCGAGCTC
GAGTTGCTGCGGCGTTCCCAGGCCGTGCAGCGTGACCTGCCACGGCCGGCGCGCGTGACCGCTGCGATCGTGCAGGACCCCGTTGACGCGATCGCCCAGG
AAATGTTAGTGATGATCCAGCACGACATAGTCAAGCACCCGTCCTCCAACACGAGTGACGCAGGCGACAAGAAGTCGAAAAAGAAGACCAAGAAGAATGG
CCACGAGGCAAGCGTGGCCGCCCCCCAGTTGACGCAGTTTTCCGACGCCGAGATGGAACGCGCACGCAACATGGTCGCGATCGAAGCCAACTTGCAGCAG
GATCCGTGGTCTGCTTCCTTCCCAGCGACCGCTGCGCTGTGGATGGACGCACAGCGTCAACTCGTCACGTCGACGGCGACAGGCAAGGACACCGTGGCCG
TCGCGTTCGCTGCCAATGACTCGGACAAAATCCGCGCCTTGCAAACCGAGTTCCAGGAGCTCAAGCAGATTGAAGCGTATCTCACTAAGCGCGCACAAAA
GCTCGAGGACCGCACGCGACTGGTGACCGGTGGATTTGCACGTCGCGCCGACGCGGCGCTCACGCGGCTGCGGCAACTGGGAGTCGACGTGCGCAATGCC
GAGATTGAGAAAGCGTGCTTTGAACGGCTCGCGCAGCTCGAGACGCGTGCGCTACAAAGTCGCATGGTGCGTCTCGCTAACGACGTGAACGCCCAGCAGC
TCGTCGAAGTGCAGCTACAGAAGCAGTATGCGGCACTCAAGCAATAACTGTGACAGTACGTTTCTTCCTTCCCAAAACGACTCATTGATGGTGATTTCTC
ACCACCGCATTATCAAAACCTAATAATACAAACATGCCATTCATTCGTCCTTCACGATCTCCGCGTCTTGTTGTTGGCCTTCGTCATCGACGAAAAGCAC
GGCTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCCCAACGCGAAGGTTTTCGAGCGAGTATTTGCGACGCA
TCAACCCCACAAGCGTCTTGAGCTGTTGGAAATGACGCCAAAAGACTGAGTGAGTGGCCTTTAAGAATCACTGGAGAGAAAGTAAAAGAAACGTACCTCG
TGCCACTTGGCGCTCATGGTCGACTTGTGCGAACTTGCGAGGTCGTCGAGTTTGCCCAGAAGCACCGACATTTCCTTGAACGTGAGTTCGTTGAGAAAGG
CCTGCAGCGCGAGATCCATCAGCGCGACCTTCTTGCAGAGCAGATCAAACGGCGGCGGTGGAAGCCGTGCCGCGCCAGCCTTGTCGGTGTTGCTTTCCTG
CTTCTTCTTCTCCGTGTACTTGGCGGTCAAGTCCTCGACAATACCGGCGACGATATCCAGCACGAGTCCGCTCTGGATGGGGAATTTGAGCGGGCGCTCC
GACTTGGACGCCACGTCATCCGGCGCCTTGTCGATGCGATGCTGCAGTACGTAGACAGCGAGTCCAGTTGTAAGTTGCGTCCCACGCTTTGTGCGTGGGA
GACGGCGCGCGACTGTCAGCCACCCCGAGGCCGAGTCGAAGAGCCCTTCGTTCGCGCCAGCGATCCGCATCACGAGCGACGCACCCCACTCTTTGCGCCA
TTCGGCCGTGGGGAACGTCTCGAGGAGCTCCTCGATGCAGATCGTCGCGAGCTGCACAATCTCGGGATGCATATTGTGTTCGAACTGCATGCGCAGGAAA
AACATGGTAAAGCTCATGGCGTCGTAGCCGTCGGGACGAAGCAGCTTGGTGCGCAGACTCAGCACCAAAAACGCGAGCACGTAGAGCATGTTGAGCGTCG
GGAACGGAACCGACGCTTTGTTAATGCTGCTGCCAGCACGTTGCTGAGTGGCTGGTGGCTTCTTGGT