Description :
From Genome Similarity Track
Location :
Scaffold_14:738344- 752417
Transcript NameFunction/comments
Phyin_T30-4PITG_09146Putative uncharacterized protein

Sequence
14073 bases(100 bases per row)
TGAGCCTCGGCGTTTCATGTAATGATGATCGATACCAACATGCTACTAATAGCCACTAAGGCCTCAGCAACACACTTACAAACACTGCTTGTTTGTCAAA
CAGTCAGCAAACACAGTTAGTGCTTGTAGCTACGAGCGGATGCTTTTTCGTACTGTTTTCACGAGTCTAATCTGATCGTCCGTGAATGTTACTATACGGC
ATATGGAACGCGACGCAGAGAAGTCAGAATTATTAAAATAGAGTCATGGGACACATGCCCATGGACACTCCAGCAACGAGCTCTGCAGCTGTACAAACCG
GGTCTGGGGATGGCTCGTCATTATTTTGGTGGCACTACCCATTATTCATACGTTTTCTCTCATTTGGGAGTACAGTCGATATTCGCTGCAAAAATACATT
TGCATGTTTTGCTTCTTTAAGCCGGCATGCTCTCTCACTTCGTTCATATGCGTGATATTGGCGCCTTATTCAGACCTTCTAACTCTAGCAACGACCTGTT
CACTGAAGACGACCTGAATAACATGATATGCTGCTATACCAGATAAAAGTGTTGTCCACGGGTCATATCAGGTAGGACAGGTTTACTGTAGTCACTCTTA
TGGTGGAAGGACTCAGCGTTTGCGGTAATATTGATGATGCGGCTTCATTTATTTGTCCATCTGGGTCTGAAGCTCAAATCATACGAGTGGCAAATGATTC
TACACTACATGTACCAGTAGAAGGGGTCCACCCCCATGTTTCATGAAACTTATTTAAGCTCCCGAACAGCTTCGAATGGCAGGGGCCCATGATAACTAAA
ACCAAATCTCCTTTTCAAACTAGAGAAGATTTTTTTACATGTTAGTGGCCCTGTTGCAGTATTAATATTAGTGTGAGTTTACGATACGATTTGATAATGG
TCACAAGATGCGACCATCATCAAATCGTATCGTAAACGGTAGTCAAATATCGAATGACATTTTTTTGATAGTAATAGTACTTCGCTACTTTTTAAATATT
AATAGTAGCTCAATTTTCCAGATGCTAGCAGAATATTTTAATATTACAAGTCAGAGATACGAAATAGATTAGAGCCTGTTCACTACGTAGCTGGAGATGG
AGATGAAGGCAACAAATCTTGCGTCTCCATCTCCAGTTTGGTCGCCAGAGAAATCATGTCTGTAACGGGGTAAGAGATACCGTTACTAGCTTACACTGTA
ATGCGGAGGAAGCTCGCAATAATAAAACCAAGTCTTAGGTTTGTGTCAAATTCAACTCTGATTTATTTAGGACCAGGGCGGCTACCCCTGGCCTCGTGTG
AACCACTCAAACACATGTCTATATCTGATTGGTCAATAAGTGAGTCTGGCTCCTCACTATCAACCAATCAGATGATGACACCTTGGCACACGCTACCCGT
GTGCCACTTTACCTACTTATGTAATAACTAAAGAAATATCTACCTACTTATGTAATTGGAGTTGGGCCCATTACAATGTCCACCTAAATTTCAACCAATC
AAACCCTATGTTGTTCGGAGTCGTCAGTCAGACAATTGCCATCATGCCAGCTCGCCTCACATGCGCTGCCGCTCGTGAAGATGGAGGACTACATCCTCCA
GTTGACAACAGTAGCACCGACGAGCTATCCCCTCTGGCGTCTACATTCGGACCAGCTGCGGACAAAGTAGTTTTCCCCTCTATGATATCAGGTGATAGCC
AGGAGCTTGTCGGCGATGGCAATGACGGAGCGTCTAGCTTTGTTCCTATCTTTCGTGATTCTACATCTTCACCGACGATGCCAACGCCTTCTTCACCACC
TACCACCTTGGGGCTTGTGACAGCAGCTCCACCTCCAGCACCCCGTGGCCGGCATGGAAAGAAACCTGACTCGAACACGCCGTTGGCATTTGCATGGACA
TTAAAGGCGTCTGAAACGCTTTTGCGTGTACGCTTTGTTGCGATGAAGCATCGTTTTCAGGGCACCAGAAGCTCGAAACAGCTTGCGGCTGCCTGGAGTT
TGGTTGCTGCGGAGACGTTCCGCCTGGGAGGTCTTCAGGTGAACACAGGGCAGTGTAAGTCAAAGGTACGGCTATTCTTTAATATTAGGTTAAAGTCGTT
TTATTAACTGAGCTTTGAATGCATGATACGTAGTTAAAGCACATGCACAAACAGTATACAGCGTATCGAGTAGCATTGCTGGATACTGGAAATGCTACGG
AGAAGCAGTTAAAGGAACCAATGTGCTATGAGACGATGTGCGACGTGTGGAGCGACCACTACGGCATGGACGCAGACCCGTTCTTTTCAAGTGACGCCCC
AGAAATCTCTGTAGGTCGGTATTTAACCGAAACCGATGACGCGGTGATTGATGAAAGCCCGAGTAGCGGTGGGTGGAGACAGCATGCTGGTAAACGCACG
CGAGACAAAACCGAAACTGCTGAAGGAATGAAAGCTATTGGCGAGGGTCTCCACAGCATTGCCGAGGCGTTCAAGGTGTCAAGGACGCAGGTAGGTGACA
ATCATAGCCGTGAGCTTCTAAGCTCTATTCGAGAATTAAGTGAGACTGTGCAGGCACAGACCCAAGCACTTAAAAGCCTCATGGACCTCATTGGGGCCAG
CGTCGCCAACAACGCGGCCAGCAACAACAGTTAGACTTGCGCGGACTAAATCGCTACCACTTTCATTGTTAACGGCAAATTTGACTGGCAATTGCATTAC
GTTTAGAAATTCCTATATGGCGTTGATTTCTACTTTGTTCTCCATCATAAATGTCGGCCTCAGCACTATTGTTATTGTCTTCGACAAACAAAGGAATCTC
AGTGGTGTCTCGGAAGTGGATCATCAAATTATGCAGAGTCATGGTTGCAACGACAAATTCTGCTGCTCGATGAGGTGTTTCCTGACTCATTGGGCCTTGC
AACATTCTGAAACGACCTTTCCAAATTCCAAAGGTGCTCTCTACAGCCATGCGAGTACTTGAGTGCAAAAAGTTAAATTGTCTCTGTCTGGGTGACAGCT
CTCCACCCTCTTCCCGATCACTGTACGGTACTATAAGTCCAGGCAGTAATGCGTATCCAGCGTCACCAATAAAATGAGCTCCTGGTGGTATCGTACTGTA
TACCGTTCGACCAATTTTGCTATACTGCCAGCACTTTCGATCCGACCAGGAGCCAGGACGAACTTCAGCACTCAAGAAAACATTATCACTGGTGACGATC
GCTTGCACATTCAACGCCGGGTAGCACTTGCGGCAATAAAAACCATCAAACTCGTAGGGACGCTCGACTTCAATTAGAGATCCATCAATTGCACCTACGA
CACCAGGATACCCATGTCGCGCCGCAAATTCTGACTCGATTGCATCCCAACCGCCTTGGTCCCGTGGAAATGCCACAATTTGGGGAGCTGCAGCCCTTAG
AACTCGAACAACTTCTGCAGTAATTTCTGAAACGTAGCTCCTACACATACCCATTGCACCTCCAACCTCCCTGTATCCTCCGGTCGAACCCATGAAGTAA
AGCGCAGCAGCGACCTTTTTGTTATAGCAGTGCTGCTTCGATTTCGCCGCAGCGAATCGAACCCCCTGACATTGTAGGAAGTTGGCGACGCGTAAAAAGG
TTTTCTTGGAACATCGAAGATTTGTTTCAAACCAACTGTCGTAGCTCCATGACAAAAGCATAGGCTCGAAGTCCAAAACGGTCACAGTGAGAATTTGTTT
CTTGGGTCCTGGTGGCGCACGCTCACAAGTGGAGGCGAGCGTCTGCGCGACAGCAGCACACGTAGCAACTATAATAGTTTCTTCATCATCCATTGCACAG
AAACAGTTTGAAAACGGTATTTAGTCGTCTCCAGCCGTCTCGACCTCACAGAGGTGGAGAAGGACGCAGGGTGAAACTCTCCAGTTGTGTGGTTGTAAGT
TCAAAATTTCGGCCAATCAAGTATAAAAAAAAAACTGATCGTAAATCCATCTCCATCTCCATCTACGTAGTGAACAGGCTCTTAGATAATAGATGATATT
TTTAAGATATTTTCCCCACTTAGGTACGTATCTTGCCACCTTACCCTCTGTGAACCTAGCGGAGCCAAAACCTTTTTCGATCAGGTTCTATAAAAAGAAG
TATGCTTTAAGACTGACGAGTATTTGCTCTAGTATTTCACTGTGACACAGACAAAGGCGATCGAGATGGAAAACTGCAAACGCTTGCGGTTGTTTAACGT
CGATAGAGCGAGATCAGGCATTTGTTCTTGTTCTATGTCGATTTCCTCGTCCACATCGTGCGTCTTATAAACCTGCTGCCTGTGGCGCTAGATTAATGCG
CTGAGCAGTGCCAATACACGACGCCAACTTTGCCGTCACTCTCACAAAATTGTCCCTCCCTCACGGTTGATTAGTAATACCTCAGCTAGTCGAGCGCTAA
CGACATCTGATTGGTGAATTTTAGCCCGATTACGCAATCTTAGATAATATAATACTGTATGGTATTAGCTAATATTAACCCTTCTAGCCCGGTATTCTGT
ATCCTACAGAATAAGATGTTTAACAGGATTTAGTACCCAGCAAAGTTGGCTGCTGCCCCCAAGTCCGCATATGAGAATTTGTATACGTGATAATCAGCAG
ATCCTTCCCGTTGGATCGGTGAAGGGTAGATAGACGGGGATTCTTCTGTGTGAGTAGAAAGACCAATATAAAATCAGAACAGGTTTGAAAATTAGAGTGA
AAGCCCAAAACTGCCGCGTGGCAATCAGTCCCTCCCATTCGAAAATCATCTCTGAACAATGAACGGCCCCGGAGAGAAGACATTCAAGCAGCTGTGGCGG
GAGTTATGCAAGGACGGATGGAAGCCCCGCAAACCCACGCGCATGGCCAAGCATCACCGCTACGTGAAGCCAGGAATCAAGGGACGTCTTGATGAATCGA
GACGCGGCATTGACTTTTTTTAGGGTACGTTGCAGTGCTAACTGACCTAATAATGCTCAATACTTACAATGGTGTGTTTATCAGGCGAAGCTGAACTCAT
GGCGTTTGGACGTGCATCCGGTCGTCTCCAGCTTCCACTCCCAAGCGTGCGTGTTGGCCCTGCACATCGTCCGATTGGCAAGCAAGCATCGTACGAAGCT
GTTGGGGAGGGACCTACCCATGGCCATCCACCGCTCACCACTTCCGCGCCACCACCTTCCGTTACGGCGACTGAATCCGCCCAAACTCCAAACGTTAACG
CTCCTCAAGTCAGTGCACGTGTTCAACCTCCAGCGACCGCTCCGTTGACGCCGGAGGTGAATCCGGCAGGACTACAGCCATCGACTGAAGCTCAAGCTCA
ACTGGCTATAACGGATGGTACATAACAAGATGAAGCCTTGCAAGGCCACGATCTGGATAATACAGAACATGGGAATACACAGTTTACAGTCCCGGGGGAT
ACATAACAAGAAAGGAGAAATGAAGGCTCTGATACAGAATGGAACCCGCGAGAGACATCGACGGAAGCTGATGAAGCAAAGAGCGAGAGTGACGACCCTG
CGGATTATCATGTAGATTTAGATGTCTTTGATAGCCACAACTTCATGGAGGGTCTCTGAAAAGAGCGATTGTTCGGCCCGACAGATGGTGATGATGTGAA
CGTGGTGGCTGGTCAAGATGCCAGCGACTCCGGTTCAGACGCGGATAACGAAGACGTGATGAACGACAACGAAGTGGTCCTTGAAGTAGAAGGTGTAGAA
GATCTAGAAGACGTGTCTTTGAATGATGACATCCCCGAGGAGGGACTCTTTGACCTGACTAGTGGTGATTTGCGAGACATCGCGGAGAATGGATGGATTA
CTTATGCCGAAGCGGAAAGTGGGAGGCGTATGATACAGATTAGTGTGTGGTGCAATTGTACTTATTCCGGATTGTGTGTTTACTACGGGGAATCTCCAGA
TGGACGCTGCAACGGACTATTACGACGGACCGTGCGGACCCACACGGTCTGCGGTCGCATACGCAGACTCTCCATTGGCCATGTTCTTCTACTTTTTACC
GAAGGAGCTATGGATTCGAATTGATGATGAGACGAATCGCTACCGAGAGCAGAATATTGGTGCTGTGGCATTATCTCGTCGACCAAAGATGCTTGCTCGC
CAAGCTGAGGATCCTCGCGTGAGTGTGCCCAACTTAGAAGATATCGAAGTCAAGTTGAGGAAATTCAGGCGTATTCAAAGCTCATGAGATTTTGCACGTC
GTGGGATTGCTCTTTGCACGAGCTGTCGCTCCGATTCGAGAAGGGCTTTCTAATCACTGGAGTACAGAAGAAGATGGAGCCATTCCACGCGGGATGTTCT
CTCGCTTCATGAAGCGCGATCGCTTCGAGGCGATCATGAAATTTCTGCACTTCAACAACAATGATGACGGTGGAGCGCATGCTGACAGAGCTTGGAAAAT
CCGTCCTGTGTTGCAAGCTGTTGAGAAAACATTCCGCCGTGGCTATCGCTTGGGTAAGGTCATCTCGTTCGACGAAGGCATGATGTCGAACCGCAGCAAG
TTCAATCCGATGCGAATCTTCATGCCCGACAAGCCCAGCAAGTACGGTACCAAGTTCTACATGACATGCTGCGCAGATACAGCATATTGTTCAAGGTACT
GCATATTATTCTGTACATCCTTGAATACGCAATTCCGGAGGCTACAGAATACACTGACACTCTCTCATGATATGCTGTATCTATCCGACTTAGAGTGGAA
ATCTATTGTGGGGCAGACGGCAAAAAGAAGAAGACGCCAAGTGCATGGTCCAAAAGCTGTCGTTAGAAACATAACGAAAGCCTTGGTGGGTCAGCCGAGG
AAGCGCCTGATCGTAACGGATAGCTTCTACTCAACGGTCTCACTGAGTCTGAAGCTGCTGGATATGGGTCTCTATCATGTTGGCACCACGAGAACTGATC
GACTTGGCTGGTGTCCGATCCAGTTCACGCAGGCGAAACGACCGAAGCGAATGCCAAGATAAATTTATCGTATCGCACAAGCACGTGATCACCATCCGTT
AGCTGCATTGAGTTGGATGGATTCAAAGCCCGTGAACATGCTCGCTGCTGGTTGCAGCACTCACCCCGCCAGCGTTATGCGCTTGGAGAAAGATGGCACG
CGAAGCACGGTGCCGTGTCCGCAGCTGGTTGTGGACTACAATCGTGGCATGGGCGGCGTGGACGTCCACGACCAGCTGAAACTCCAGCGCTACAACATCC
AAAAGTGTATATCGCTTCGCAAGTACTACAAGCAGTCATTCCTGTGTATCGTAGACATGGCTGTCGTGAATGGATACATCGTTCACTGTGTGACGCTCAA
GAGGAAAGAAGAAAAACGACCTACCCATGCTAAATACCTGCGTCGATTGCACATTCAGCTGCTCGCCCTGCAGACAATCAACTTCGAGACCCACCCCAAC
GCAGAGGACCTGGTGGCTGTACGAATTCCACGTCAGCAGCACGCGTTAGTGAGCACCGATAACTTCTTTTCGTCCGGCAAGCAGCACAAACGCAGGCAGT
ACCTGTGCAAAGTGTGCTCCGCTTTAGCTGACTCCAAAACCAAGTCATTTGAAACCAGTTTCTTCTGCCCGCGATGCAGCGATGCCTTTGGAGGGCGCGT
ACCTCTCTGCCGTCACGTGCGGCGCGTGGAGAGCGGGAATACGCTGACTTGCTCGCAGATTTGGCACGAGACGTGGGGTGACGGCAAGAGCGTTCTGCCT
AGCCTAAAGAAGAAGATTAGATTCCGTAAGCGTAAGAGAGAGAGTGATGAGGAAGCGTAGGAAAGATAGTAGGAAGGGTAAGTCCAAATACCTGGTAATG
CGCGGCGCGCGCGCAGAGAAAGAATTTGCCCAGTTCCTAACTAACGGTTTAGCGACGAGGAACAGGGCAAACTCTTCTCTGCGCGCGCGTCGCGCAGTTT
GGCGCCACGAACGGATGGCTGTCGTCAAGGAGTTGGGCTGCTTGATCGGCTTCATGAGCCTAAACGAAAATCTCGGGTATTGGTAGAATGCAGGTATTGA
TTGTGCTCTAACCGAAAATGAACCAATCGAAAATCGCAATTTGCGCAGCTGTTGGGTACATTGTGGACGCTATGTCCACTGTCGTAATGTTTCTGTGATA
AATTCGCCTAGTTCTTGGCCATGGAGAGCGAAGGGGGTTGCAGCAGGATAATTATGGGAGGTCTCTGAAGTACACTTTTATCAAGTATAATTCCTTATTC
TGTAGGATACAGAATAAAAGCTCGGGCTAGAAGGATTAAGTTGATACAGAAATCTGCCTGAATAAGGTGCGCCTGATATAAATTGAGAAAGAGATTGCAT
AAGCTGACAATGCCTTGCTAAAAACAGACTATGATATCGGATCATGTGCATATATTGAATTAAGTTAGGATAAATTGAAGATTCGACTTTTGAATGAGAC
CAGAGTGATTCCAACAGTGCTGAATCGTGGAAGAGCTAGCTTTAGACAATGCAGCATCGCACCAGAGCAGTACAGCTAGCTGGTCGACGCTGTACGGGTT
GCCGAGGGCCTTCGCCTAGGCGATCCACTCAGCTAGCTCATTATACGACAGATTAGGTGAGCGAGCAGCCTTCTCGAGGATGGCTACCTTCTCGGACCAG
GTGAGGCGGAGACGATTGGAGGAAATGGGGGTGCTGAGGACGCAGTCGGCTAGTGAGGTTGAATGTAAGTGTAGGAATGAAGCTCGGCTCGTAGGGCTTG
AAGCGAAGAAGGATCACCTACTGCGCGCCATTTTTTAAATTGAAATCAATGTCAGTGCCTGGATTGTTTTGTCAGTACCTTGCCCATCACTATCCCATCT
CCCTAAATCTTTCCCGAATATAAAAATTGCGAGGTTATTAGTTGAAACCCCGTTCCTTATTCAGGCAGATTTCTGTATTTGATAATATCATATTGTCTCA
GAAGAAAATATTAGGTGATAATTTTTATATTAGCTGCTCTACAGGTGATATTTTCACAATATTAACTTCACCGATTTTAAAGTTACCATTAACCCCTGGC
TGTAGCTCCGTTTTCGTTGCGTGTCCCAGATGTAAGTGCGGGTGTGATAAGATAGATCGTAGCTTTTCTTTTTATTTTGGTGTCAGGTTTGACACCAGGT
TTTTCATACAGGTTTCTGCCAGGTTACCGAACTTGTTTTCTTTTCAATACTGTTTTGGTTTCAGGCTAGCAACCAGGTTGTTGATGCCAGTTGTTTACCA
GGTTTGAGCACTTTGCATTTTCTTCAAGGCGTCGGTAGCTTCTTCAGGTTTTCTCTGTGTCTTTCATGGACAAGTTTCACTACATTTATGGTGCGTCTTT
TGCACAGGAGCTTACGCTATAACAGCAATACGTACACATCAATTAAACAGAGAAAACGAATGTACTACAGATTAAGCAGTGCTGCTAGCACACGTAGCCG
GAAGTTATGGAGTCCAGAGTCCTTATGCGCACTCTTCACATTTTCGTCAAGCAGTCTCCACATGAAGCTCAGAATGTATATTCCGCAGCTGTTTCAATCG
GCTTGCGTCGGCGACGCGACCAAAACCGGTTTGAAGCTACTGAACGCTTGATCTTTAGTGATACTGCTCTATAGCTTGGTAAGAAACGTGATGTAGTAGC
AGGATTTACAACAGGATCCGTAACAGGTTTACTGCCAGATAACAATACAGGTTCTTCATCAGGTTTCATTACAGGTTTATCTTCATGCCCACTTCCAGGT
TTTTCATTACGTTGATCCCTCAGGGTTTTCTTCTGGAGTGCGTCCCACCCAACGTTGGCAGTCTTGAAGTGAGTAGGAGCTTTGCGCATGTGCCAGTCGG
AATTCGTTTTAACTAACGAATGCTGCACGAATTGTCCTCGTCCGAATGCATCCATAACCATTAAACTGCAAAGTTGGTAGTCATATCTGAAGGCACAAAC
GTGAACCGGGTTAGTAAGGATTGAAACATGGTTTATAAATGATAGTCAACCTGGCAAATCATTTATGTGAAAGCCTGATGACTAACCCGGCATAAACCTG
GGATGAAACCTGGCAAATTCCCTATAAAAACCTTACCTGTTGGTTTTGTGGGTACAGTCATCCAACAAGAGCTCAGGAAACCTGGCGAACTTGGCTCGCA
TACGTCCTGTAGTCAGCGAAATAGCACCGGTCTCTCCGGAAGATGTATCGTCCACACTAACCACATTGTCTTTGTCCTCTTCACCAAACCTACATAAGAA
ACTCTGCAACAGGGGCCAAATCGTCGTCTACTTTTCGCACGCATTTCATTGCGAAATCTTGACCGGGAGGTTAGCCACGTCCTTGCGCGTCACCTTGTAG
CTTGAATAGTCACGAATGTGCTCGTAAATGCGCAAGCGATTACCGCCTGCTCAAACCGTCAGCCGGAGGTCTTCAACAATAGGCTCACACATCGGTATCT
GCTGATTATGTGGATAGGTTTTGTACACCACTTCAGATAGCGCGTGGTTGTGCGTGTATATAGGGTTCTTCACATCTACAATCCACTTGACCTTGACGAA
TGATACTCTCGACTGTGAATCGAAACGGACAGCCAGTACCACGAAGTCGGTACTGCTGCCGTTTTCCCATACCACAGCGCCGAGGTTTCGGTCCATGGGT
GCAAATTTACCTGCGTCGCCACCGAGATAAGTCGTCAGGTAAGTAGCGGACTCCTCGGTCACTCTTTGCACGGTTGGACTCACGCAGCTGCTTGTTGCGC
TTCGGCACACTCTCTGCTTCTTGAACGGCTAGATACCCGTTCTCCTCCTCGCAGTAATTAACGCGATACCTCTCCCAAGCGTCCCAACTGGCGTGGAGCC
GCTTCAGCTCCTTCCCTTCAAATGAATCTTCCTGGAGTAAGAGATCGTCGAGTGAGTCTTCGCTGCCCTCCTGAACTAACTGCGTGTCCTGGGCTAGCTG
TGTCCGGTCCGTGTCATCATCGTCGTCGCCTGAGCTATCTTCTCCTCCACCAAACGCTGACACAGCTTCGTCGTCTTCGTCGGAGTCTACATCTTCCACA
TTACACAGTTTACGCTTCATTGTGGGCTTTCGGCGCAAATTGAGAAATGAGAGGCCAGGAGAACGTTGCACCGCCTACCGTTGTACCAAATCTAAAGATT
TGATAGGGTAAGGGGAATCTTTGCACATCCTTGTAATTTAGTTTTTAATTACATTTTGGTCAATATCTTACTGATTACCTGGTCAGTACCCTGGTCATTT
TGTCGCACGGCTATGTAAAAAAACCTGGGCAGTAGATTTTCCGTTAGATAATAGATGATATTTTAAGATAGTTTCGCCACTTAGGTACGTTTCTTGCCAC
CTTACCCTCGAGGGCTCACAAAAAAACTTTCGGCCATCCTCTAAAGCAGCAGTAGTGATGGTAGGCTTTAAAACTGACAAGTATTTGCTCTAGTAATTTT
ACTGTGACACAGACAAAGCCGATCAAGATGGAAAATGGTAAGCGATTGCAGTTGCTCAAAGTCGATAGAGCTAAAAAAAACATTTGTTCTTACTCTCTGC
CGATAGCCTCGTCCGGATCGTGCGCCTCATAAACCTGCAGCCTGTGATGCTAGATTTATGCGCTCAGCAGTGCCAACACACCACACCGACCTTGTCGTCA
CTCTCACAATTGTCCCGGACTCCATTTCCCTCACTGTTGATTAGTGATATTTCAGCTAGTCGACATATGATCAGGGGCTAAGGATATTTAATAGAAGTAA
CCTCAATATCAACAAATTTTGGCAGTATACACCTCAGGTTTAGTTATAGCCAGTTAAAACCTGTACAAAAAACGCCACTAAAGAAAATGGCTTGAGGCCA
AGCGAAAAAGACGAGTTCTACCCTCCATCTATCACCCCCCCTGGGGTTTAGTGGTAAGCTCGCTGACAAAGATATGATTATAAAATCGTAGTGTTGCTAA
TGTGCTCGGTATGGGTCTTGTTAGGCCTACTCATTCTACATGTGTCTGTTTAATCTTCTGGAGTAACATGGTCGTACCGATGTCACACTGCATGACTTTT
TTTTCAATCTGCAGAGGACGCTGGCCTCTCTTTGAAAGACGTTGCGCTTAATGACAGGACGTCGATCTCTCTAGAGTGTACACTGGATCCTTCAACCTTT
GAAAATGCACAGGCTTAGATTGCACATGGGTCGTAAAATTGAATTGCGGCGAGGTCAAAACAAAAAAATCGAAACTCAGCTCAATTCCACCAGGCTCCTG
ATTCGTTAGTGGAATGCATTTACAGCATCGTGATCTATGTGATGCTGTGCCCGTGCTGTCTGCTAGTCAAGTTGGATGTCTAAGTGGTTTTCAGTCTACT
ATTGTTCCTGGACGCGAAACCTCTCGACTTCGAGTAGTTGAGTCTGGGAAAGTCATTAACCACGCCGATTTGAACGATCAGGCGGCTACCGTCTATCGTG
CCATTTCAGCAGCAATATTGGCTCGTATATCTCTAGTAGAAAAAACAAGTTGGATATGACACCCTAGTCGCGTTTTTGCTGTTATGAATCCTGGATCGCA
ACGAGTATTTATTGCGATCGGTACTGTCATTTCTCGTATAAATAATGTGCTGCCTGTGTATGAGATCGATGGAACTAACATGAAGCACCCTCAGTATAAT
GGAGTTTGTCTGACCTTAATTGGCAAGGATGGAAACAAAGGAAATATGCTCGTTGCAGCAGGCTATGTATTGAAGGAAATGTGGTGTAGCGGGATCAGTA
AATCGGCGAGATTGCTGGATCCAACTTACCAACAGCGCCCAGACACCGACAAACGGAGGGGGCCCCCCGATGATCCGTGATCTGCTGAACTTTCCTCACC
TTCTGTACCCGTGGGTAGGGCGGGATCTTGCTCTCTGGGTAACTTCCAAAGAGTTCAAGTGGTGTCTTGGCGTAACGTGGGGATGGGGTGGTAAGATCTT
CACTCTGCGTCGGTAGATGTCTCTAGACCCTAAGCGAATATCTGAGCTTGGTGAATCCAGGGCCTAGATCGTGGATCTGGCCGTAGGTTGCCTGGCTGGT
GTGCTCCCTTGCCTTTGTGTTTCCTTTTTGGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAGCCTCTAGGGTGTTGCCAGCCAAGTAG
TAAATCCGGTTAACCCTTCGGATCTGCACGTGTAAAGGAAAGCCCACTAGATTGTAGGATCTGGCCAATGTATTATTCAGTTATCACTACCAGCACTCGA
TTCGAAATTCCCAACCTTTTCCGAGCTCGTACGGTCAATGTAGTTCCGATTCTTGAGTGCAGGAAATCACTTGCGTGATACTGTGCAAATTGAAGTCTGT
ATTGATACTTAAGCCTATACCTGCCTGGAGTTCTACCTTCTATGTCTTTTACCTGCTAAATCCTCTACCAGGCTCGGCTGCATGTCTTTTATCTCCTTGA
CCCGTCATCCCAGCTGTATTATCATCAGATTCACCGGATCCGTGGCGTAATCATTAGGGTCGTCACATTATGGATATACTTGTCCGGATCCAGGCCACCT
TGATCCACCTCTCTACAAGCATACGCTCATCATGGATCTTAGCTCTCCAATATTCCCACATCGTCTTGCGACCGTCTGTGATCTCCATCGTCCCACGAAA
GTTCGAGATCCATTGCATCCACCATCCCAATATCCTGGATTCAGGTCACTCCGTGTGGGATCCTCACCCCCTTGGATCCGGACTTGGAAGTGTGGGATCT
GGGACATATCGTTGTGGATCTTGCCTTCTCGTTAGTCGTTGTTACCAGATCCACCTTCAGATGACACCTACCATCCTTCCTTCATAGGATGCCCACTTGA
TCCACCTGTACATGGTATATCCCAAATCCCTTAAGAGAACTCAGGTGAGGGTGGATCCGAGTCTCCCTTTGGAGGATTTTACCCTCCCATACGTTATCTA
TACCAGATCCATCGTCGACCCATACCTAACGCCACTTTATCTTGGCCAATCCACTCCGAGAAGCGTGGATCCATGCCGGGCGATCCAAATCCCTCCGAAC
CACTTGGTGCTGTCCCTAATTAGGGATAGTGGCCCCTTGTTAGATCTGTTCTCTTATTTCTGAAAAAGCACTT