Description :
From Genome Similarity Track
Location :
Scaffold_36:73820- 78318
Sequence
4498 bases(100 bases per row)
TCCAAACGTAGATTCTTAACTAAAAAAGTAGTCCATTTCCTACTACATAAAAAAAATAAAAATCACACTTACTCACAGCGAAATTCCATCATCACTTAAC
ATACTACGTAGCTCCTTTGAACAAGCATACACTCTATTCATCGAATCGCCCTGGGTATTATTTAGCTACTTACCGATGCTCGAGTACAAATGATAATCGC
GACGGTATTGACAGAAAAAACAAGCACACGAGCGCATTTCGTTCACCCGCGCGATAATTCATCCATGTATGCTCCTATGACTCTGTCGCTCTCATCAGTA
CATATCCACATCGCGCACCTCGTTGCCAAACATCGTCTCTCTACACTGTCATCCACATCGCAGACCTCGTGCAAAGTAATGACTGTGTTTTCAATTTAGT
CAAAGCCGAATAAGCTTAGGAACACTTAGATAAACACGTGTGGCCATCTTAGCCATCTCGTCCATGTATTTAGTATATCTATGGAAGCGGATCACGAAGT
AAGCACTGGAAAAACGTCAATAATAAAAAAATAACGCTTTCAAAAAACGGTAAACTTATAATACATGTAACGTGGTATCGTGCGCAAATGATAGCATTTT
TTACTTGGGTGGGACATTGTTCTCGGCGCAGCACTCCATTTGATAATAGAATTATTGTTTCACCAATTTCCACTTCATCTTCAACTACAGAACCAACTTC
ACATAAAATGGGTGCTGTTTCAAACACGTCACTTCCGAAGTCACAGTTTTGGTAACAGATCCGAAATGTAGCGGGGCACCGGAGCAACAAACTGGACAAC
CAGTGTGGAGCTACTATCACCACCAGTGCTAGTGGTGCCTCGCTACCTCTGAGCAAACGTGCAGAGGAAGGAAATCAACTAGAGACAGTCTAGTTATTGG
TAAAAGTAAAACTATCTTAAATATAATGAAGTCCTAATCATTAACCTATGTATTAGTCCTAACTTAATTATATATATCTGCAAAAATGTATGCTAAAATC
TTGCTCATGACTCATTGCGCGCGTCCATCGTTGGTTGGACCGCCAGTGCTAGCTGATATGATGACCCATATCAGCCAATCGGCGAGTGTTTCTGAAGAGT
ACCCCTTATGGTAATATTCACGAGCATTATCAACCTTTATTTATAATATCCTGATTAACAAGTATCAAGGGTTACTTACATGTAACAGGCTCACTCCGTT
ACACGAAATTTTTTCCTACTATCACACAAAGCTTCTCAAGATACGATCCCGTGAGTGGCTCTGTGCACATGCCCGACGGATTGTCATCTGTATGAAATTT
TGATAGCTGGACGGTCTTCTTTTCAACTTGATCACGCATATTGCCAATAGATCTGATGCGTCGAGTACGTTGACTATAAGTAGGATTGGTTGCCATTGCA
AGGATACTTGATTGTTAATTCTAAACGTACTACGCCTAATTCAGGAATCATATCACTTAGCATGTTATTCAAACTTTGTCCATCCATACAGAATTAACAA
GCCTCAACATACTTGGCCTCTTCAGTGGTATATTTTTTCGCCTTGACGCCCAAAACGTTTGCGTTATGCTAGATTTATGATGTAGACAGTAAACTTTCTT
TCTTCAGATTCCTGACCCCAGTACGCGTCATAGTACTCATCAAGGTCCCTTGTTATCGTGTTTTTCTTGTCTATGCTGGTGGATTGCCAATGCCCTGACT
TTTAGTTTCAACGATATTGCACAGTTATCTTTTAGCTGCATCAATGTGCTGTCGAGTAGGACCTTGAGCATAGAGGTTTAGTTGTCAAACAACAAAGGCA
ATATCTAGTCTGCTGCAAGTATCGAGATACATCAAGGAGCCAAATCATTTTCGATAGGGAAGTTTTCTCCAAGATAGGTTTCTGCTTGCTATATTCGTTT
TAATGATGTAAAGGTTTCTATGTAAATCCATTGTTGTTGCTACAGGTATCTTGCCGTTATGAGCTTATGCAAATATAAAATAAATCAAAAATACAGTGCA
TATTGCGTAGCTGAATCTTCATCAATGTATAGTTCGCTCATTTCAACACCCAAGTACTTTTTCATCAACTATTGATCCCTTAGGTCGTATATTTGATCAA
TTTATAAAAATAACTCTCTTTAATTGTGTCATCTCTAATAGCCCAACGAAAATCATCGACTTAGATCAACACAATGCAAATTCCTCATTTCGGCTGTACG
CATACGAACAGGGATCTGTGTTTTTGCGTCTATATTTTTTTAACCATTTGTCGAATTTAGAGTTCCATTTCCGACCAGAATGACTTAGGCCATTTAGTGC
CTTGTTTACCATGTAGACATATCCTTCAGGATACCTTCAAGTCCATACAAGTACTTATTAATTGATAATTCACCATATATATACAGAAGAACTGACGCCT
CCTTGGTGGACCTTTAACCCATTCTACACACACATTGAAACGAAAGATATGAATGTGAACATTATCGCGACAGGAAAAATGGTTTATTTGTAGTCGGTTC
CGCGACACTGCTTGTCACCACGTGCAACTCGCTCAAAATCGGACAACATGCCTACACGAGCTGAAAGTTCAAATCTAGCACCCACATTGTATTTTTCAAA
GTGTGTTGTCCAGATAGTATTTCTTACCTTGGTATTAGGTTAAAAGCTTTCTTGTCTTTCAGTGCTTTAATTTACTTACCATGGAATTGGCCCGAACTTT
CTAGTATCTTGATCTCATCGGTTCTTTGTATTTACCTCAATATTTATAGGAGTTTTAATATTACATGCGCGAATTTTATCTGACCACATCTCGTTGCACG
AAATGCCTGAGAAGATGATATACGTCATAGTCTTCATTTTGGATTTTAATTTGCTTTCATGCAGTTCCCAGAGTCCTGGTCTGTGTTTCTCTAATTTTGC
CCGTTCACATCAATCTTTGAGCGTTTGCACCGAGCTTCGATGTCGCGGGGTCTTCGATGGCCAGCTATCTGTTTTGATGGCATTGCCAATTGTTGGCGTG
GAGCTGGGACTAATTGCTGTTCACCAACAAGCTCCTCGTTGGCAACACTGGCTTTAAGTTTATTCAATGAGTCAAATATGTCATCGTATATTCCCTTTAC
ACCAGCATCGTTTGCTCCTTCATCGTTAATGTTTGTTATGTCAGATACATGACTCATACTTTCACACATGTATTCATTGACCATGTCAAAACATGGCATT
TTCCTCAAATTTAATCGTTTTCGGGTCCTAAAACTGATTCAGAAAAAGGAAAAAATACCCCATTTAATCACGAAAATAAAAAATGCCCCAGATAATTAAA
AAATTTAAAAAGCCCCACGTCCTTGTATATTCAAGTTAAAGTGGTACACTTATACCGACATGGTGCTTTGATGAAGGGCTTATCCTATTATAAATCACCA
TTCACACGCAATGTGCTAATTCGTCTGACTTTTTTTTACCTCTTAAGCTCTCCACTTCCAGAGCGCTGTCTATCGAGTTTAAATTCATTAGCATCACCAA
CTAATCCCTGCAACATCATTGAAGTGTCGCCATCAGCACTGGTATCGCCTTCAAATTAGTAAAATGAGAGTAAAAAAAAACCTGATAAATTGGATTCATG
ATAGTCTATTTAAAGGTTAAATATGCTATAGTTACGATCGCGTAAGAGCAGGAAGCGAATGCCTATCCCACAACTAAGCAACAATAGCAGCGACACTGTA
GTAAAAAACACCACAAAACAGTAGTAACACCACGAACACTAACAGCAGTAGCAAGATCATCAGTAGCAAAAGGAGCAGTAGCAACAGCAAAACAACAGCT
ACACCAGTTTCAATTCTATCAACAGCTGAACGACAACAACAATAACAATGATACCAGCAGCACCACCAGCTGCACCACCACCACCACCAGCAGCAGCAGC
AGCCGTAACAAAAGCAACAGGAACATTATAAATAATTTACAACAACAACAGCTACAGCAGCGGCGGTAGCAGCAACAACGACATGAGCAACTGAAACAAA
AATAACAATAACGCCAATTATAACATTAGAAAACAATAACAACAATAATAAACCGATAAGAAAATAATACCATTAATCATAACGACATCAGCACCGGTTG
TCTACGTTTCCGTCCACGGCCGACGATACAAAGATGCGCTCACATCTTTACTGTGCCACCCGCGCCCACAACTGGTGGCTGGATGTAGCGCACCCGCGGC
AGAACCCCCTTCGCGGCTCCCTTTTACATGGGGGGGGGTCGAGCACAGCCGTACAATGAAAATTGAGATGTGACTAATAATGTGAATTTTATGTGTACCA
CGTTAGCTTGAGCAGGCAAGGACGTGGAGCATTTATTATATTTCTCATTATCTGGGGCATTTTTTTATTTTCTGATATTTTCCTTCAACATGAATACTTT
TCTCGCTTCGGGTATAATTGTCGATGTTCTGGATTCCTGATCACCACCCTGACTCTGTCGTACAGATCGCTTGCTGCGATCTTATCGTCAATTTCTTT