Description :
From Genome Similarity Track
Location :
Scaffold_21:73810- 75376
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_21-fgenesh-gene-0.12Formin-homology 2 domain-containing protein

Sequence
1566 bases(100 bases per row)
AACCAACTCGAGTCGCAGCAGCTCGACGACGCAACCAGCGAAAAGATCACGCGAGTGTTACAAGCGCTAGTTGAATCACTGTCAACAGAGAAAGCCAAGG
GCATTGAAGTTGTCGACCGACTCGAAAAATCGCTCTTTGCGAGATCCAACCAGCCTGAAGCGCGATCTGAAGCCACGATGATGGTATCGCCATCTTCCGA
GGCCTCGGAGTCAGCGTCCGACCCTATCCAACGAGTTCGCATGCGTCTGTTGTCAGGATTCGGCGACCAGATATCATCAGTAGCAACAGCGGGTTCACCT
AGGAAGAGCTCTGTCACCAAGGCATCTTCGCTCTTTCAGAGCTTTGAGAACTTTTTTAGTGGGTCAGGAGCTCCAACCCCTTCTAAGCCTTCAGCGAACG
CCCAGGAACCTTGCGAGCCAGGCGGTGACGTCGCTGGGTCTCCATTCTCTGACAAAGACGAGAGCGAGTCAAGCACACATGCGATCCCGAAGCTCACGCT
ACCATTCTTCCAGAGCTTTCGCAAAGGTCCCGGACTAGGAGTGACGCCTGCATCCACGCCTATCGCGACCGCGAGTGTTCGGAAAGACGCCAAGCGACAC
AGCTTTGCCGCATTCACGTCATCATCTATGTCGAGCACGTCAGAAAGCGGGTTGACTTCGAGTTCGAATGGTGTATCTGTGCTTCCGACGCTGTCGTTGA
CGCCGCTGCTCCCAGCGATTGTCAAACCAGTGTTGAACGTTCCAAGCAGACTGGAGCAAGTCAGTGACGAAGCCGCTCCAGCTGCGCCGGGTACAGGGAC
GGACGTGTCCAAGTTTCGCAAGCTACTGTCGATGGGGGCACCAAAAGAGGCTGTGCGAGCAAAGATGCGCCAGGTAGGGCTTGATCCTGACCTTCTGGAT
GAGAAGCAAGCCTTTGACGTACCTGCTACTCCGCCACCTCCGACCCCTGTCGCCTCTGCTGCATTTTCAGCAGTCGAACCCAGTGCAGCAGTGGCGTCAA
CTAGCCCTGACATCTCCAAGTTTCGAAAGCTTCTGTCCATGGGAGCGCCGCTGGCGGCTGTCAAGGCCAAAATGGTGCAGGCGGGACTGGACCCAGAGCT
CCTCGGCCAAAAAGCAGGATTCGCTGAGCCTCATGTGGCACCGGCTCCTACCGCAGCAACAACAGCATCAGCCTCTGACTCAAAATTGGAAGAAGAAGTT
GACACTGCCTCCCAAGGACCAGACATCTCCAAGTTCAAGAAGCTGCTGATGATGGGGGCTCCACTTGCCGCTGTGAAAGCGAAAATGATGCAAACTGGGC
TTGATCCTGCGCTTCTTGATGAAGCAGCACCATCAGTACCATCAGTACCATCAGCACCATCAGCACCACCAGCGACAGCTTCAACAGTACCTGTGGCTGC
AAAGGTTCTCGTGAAAGACGACCCGGAGTACGTGAAATTCTTCAAGTTGCAGTCGATGGGGGCTCCCGCGGAAGCGGTGAAGGCAAAAATGCGCCAAGCG
GGACTCAACTGCGACCTCCTCGATACCCCCGATGCCGTGCTCCCCGGTAAAGAGGATGCGGTCCAG