Description :
From Genome Similarity Track
Location :
scaffold_911:7380- 9084
Transcript NameFunction/comments
g10601.t1hypothetical protein
g10602.t1 conserved hypothetical protein

Sequence
1704 bases(100 bases per row)
TCTTGTTGTGCGAACTTCGGCAGCTTTCCACTTCTCCCGCGTCGACGCAGATACGCCAAGTGCTTGCCCAAAGGGTATCCCCAAGTCTCTTTAGGCCAGT
TGTCATCGTTTTTAGGGACAGTGAAGGCAACTGGAACGAGAATGTCGTGATTCAGCTTGAGATACGTCCGTAGTGCGGGGTTTACCGTCTTTTGCCACAC
GTTAGCGCTTTCAGGGCGGAAGACTGACGGCACCTCGTATGGCGGTAATTCCGATTTCGACGTAGAGTGACGGTAGTCCTTGAAATGGAATGGCACAGAC
CCGACGAGGCTCGGAACGGGCGCGAGTTGCAGCATGCGAACGCGAATGCTGGCGCGACGACTCAGTACCGCAAGTTGCGATGACATCGCGCTGCAGCCAC
AAACCTCAGCATGTTGGGGTCGCAATATGTATTATGATAGGTTTCGTGTTACGAAGTAAATTTCAGTAGAATCTCAAATATGATGTTAGAATTTGAGATT
TTTGGTAAAGTATCAAAAGATGGTTTTATATTTTTCACGATACAAGTAAAGTATTCTAGCGATATCCTGACCCGGAAGCGGACGACGTCTCCGATGCCGT
TTCCACGCCACTAAGAGCCATTTCCCACACAGATTTCTCCTTCGCTTCCATCAAGCAATTCAAGCAGAACCGGAGCGTGCACTGCTTCACTGCTCCCGTG
TTCGAGACGTCGACTGTCATCTTTTTAACCACGCTGCACTTGGCACACATGGCACGACGGCAGATTTGGCACGAGGAACTGGTAGACGTCAGCGCAAACA
TTCCGAAGCTCTTGTAGCACGTCTCACAGCGCTTAGGCTTCAACTGACCCGACTCACGACGGGATTCACGTTGCTGTTGACCCTTTTCCTTCATGAACCA
CGTGAGTTTCTTGACGTACGCGTAGTCGACTACACGGGAAGCGCTAATGATGGCATCCGCTCCGACTGCAGCAGCTACACGGTCCGGGATCTTCCCTCCC
GGGTTGCTGTAGTTACGAGCGTACTTCTCGACCTTCCCGGGTCCCTTTTGGCGGTCAATGAAGCACAAACTGAGCTTGGCACGGATAATCCCGAGATCCG
TGAGCTCCGGTACGCCAGGCAAAGAGATAGAGTGCATGAGGTAATAGCCGACCTTCTGGCCTTTAGAGTCCCGCGTGAGCCCGGTGGCCTCCATGATGAG
GTAGTCTCGCTGCTGCATGATACTGGACAGCACAGCAGGTCGCTCCTTCGCGAACCACTTGATACCGAGGAACTGGAACGGGTCATCGTGAGTGGGTTTA
CGGATAGTGGCCAGAATTCTGGCATCGTCGAGACGGTCGTTGATGTGCGAACTGCGCCACTTCCAGGCCTCATCGGTTGAAGCGAATGTCCCGAACATAC
AGTCGTCTAATGAGCCATCGACTGTGCCGTGCAGAACCATCACCGGGCGATTGAAAAGCGGGTTATTCGCGAAACCAGACGAGGAAGACGTTGCTTGTTG
ATCGCTCCATGTTCGATTGGAATCCGTGGAGTACGAGGTGGCTTCATTCACGGGGGACAAAGGACCGGAGCTTTCCTGCGTCTTGGAACTTGGTGCGTGA
CGTTCGCGATACACGTTGAGGCCATCGCGACCACGGATCAACCGCCACTTGGAGTTCGGGAACTTGGATCCTTCGGCAAGGAAAGCTTCGTTCGCTGCCA
ACGT