Description :
From Genome Similarity Track
Location :
Scaffold_195:738- 4884
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_195-fgenesh-gene-0.0Ryanodine-inositol 1,4,5-triphosphate receptor Ca2 channel (RIR-CaC) family protein

Sequence
4146 bases(100 bases per row)
GACGCAGCGCCAGGCGCTCAGGAAGAAGCAAACACGCAAGAGCGAGCAGACACTGGAGGCGGATTCAACCCCTCGGAAACATCCATCACAGTCGACGCTA
CGGAGAGAGAAGAGCAAGAAGAAGAGCAGCCGGCTTCAGTGACAGTCGTGCAGACGACGATACAGACTGTGGCGAACGGGTTTGGCGCCGTGGCGACGGA
AGTGACGATGGAGACTGCGGCTGCTACCACTACGTCAGTTGCAGTGGAGAGCGTGGAGAGTGGGACTGTTCCTGAGGCGATCTCGAATGGAGCGACTGGA
GATGTTCAAGCGAGTGGAACTGCGCCAGAGATGTCAAATGGGACTATTACTGCTACAGAGACAGCGGTGAATGGGACCACTACCGCAGCGCCGTCTACGA
ATGGAAGTGAAAGCGCGGTCCCTCCAAAACCGCGCAAGATGGCGTCCATCGGAGCGCCGAGACGACTGCGCAGCGGGAGTGGGAGTGGCGGCAGCAACAG
TGGAACCACTGTGTCCGCTGTCTTCAAGCGCAGCGGACGAGAGCGCACAAGCAGCGGCAATGGGCCGATCGTCGCTACTGGCGGTGGGGGAATAGTGGTC
GGCAGCATCCGCAGACGACATCGCACGGGACTGAGTCGACAAGAGTCTAGTGAAGATGACGAAGGACTCGCAGTAGCGAGCGCAGACGCAGCGGCCAAGA
AGGCAGTGAAACGTACGTGCTGCGCACTTTTCATTCCATGTTGGTTTCTAATGGTTTTGCTTTCTCCCTCTCTGTGTATGTCATTATCTTAGCAGCCAAG
AAATTAACAGCGCAGCGCCAGCCAAGTCTCCGCAATGTCGCGACCCTCGTGCGTACAAACATTCGCAATTCGGTCCGTGAAAAGGCGTCGGAGAACGGCG
GCCAAGCCAACAATGGTGATGGCAACAACAACAACAACAACAACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCGCGCGGCAAAGGGATTCATTTCAATGTGGGCGAAAGACTCGAACGCGGTTACGCACGTGTACAAAGGCCTCCACATGGAGA
AGAAGAAACTGGACCTCAAGACCGTCGCGAGCGAGTACAAGGAGATCAAGCGCCGCCAGTTCTACCAGGAGCTGCTCGTGTACCTGGTATTCCTCACGCT
CTTCTTCTCGACGCTTGCGTGGCTGCCCGTGCAGGAGAGCTACGAGCAAAACGACGTCGTGGGCTCGATCACGTGCCGAGAAGAGGGTGTGTGTGAGCTC
AAGAAGTTTGGCGACATTTATGAGTTCGCAGCGACGCTGGCTGAGCACATCTGCGACAAGAAAGGTGTCACATCCCAGTGGGTGCGCGTGGGTGGCGTGC
GCTTCCGCCAGGTGCGCGTCAAGCAGCAGCAGTGCAAAGTCTACAACGGCTGGTACACACCCTGCTACCCGTTCTACGACGAAGACACGGAGGAGAAGTC
GCCGATCCAGGGCCAAGAAGGACGGGTGTACAAGTGGCATGATGGGCTTGGCCCTCTCCAGCCCGAGCTGTACCACTCGGTGTTTGAGATGTTCTCGTCC
CTAGAGAGCTACGGCAATGGGGGGTACGCGGTGGATCTCTGCCAAGTCAAGGTCGAGGATCTGCAAGAAGACGACTGGCTTTCCGTGTCGACGCGCGCGC
TCTCGTTCGAGTTCACGCTCGTGAACCCGGTCACGCGCGTGTTTACAGTTGGCTTGCACGTGTTCACGATGAGTCCGTCGGGTCACATGGAGCACTACCC
TCATAGCTCGCACTTGCGCGTGATTGGCTTGGAAGAGAATGAAGTGCTCGATGAAGCTGCCGTACAGGAGCACCACCAGTCGACTCACGCGCCTCATGCT
CGCCGCAGCGTGTTCAACATCTTTGGTTGGGTCTTGGACATCATCTTGGGACTCTTCAGCGCTTTCGATCATCGCATCTTGCTCTGGATCGGGCTGATCC
TGTTCTTCATCACGTACAGTATCGGCGAAGCCACGGAGATGTCGACCATGGGTGCGAGCTCGTACTTGCGACTGGACATGTGGAACGTGTTTGAGCTCTC
GCATTTGGTGCTGCTGGCGTTCATCCTGGTGTACATGGCGCGGTTCTACATGGCGTCGAGCACGTTTGCGAAGGATCTGAGCGTGCTCATGAGTGGTAAA
GCGGCGGAAGAGATCGACCACTCCAGCATGCAGGTGCTGCTGCGCAATTTCCAGCGGCTTTCTGATGTCGCGTCGCTCGCGTCGGCCGTCAGTTTGCTCA
AGGTGTTCAAGTTCCTGCGCATGAACTCGACGCTGAACTTGCTCTGGCGCGTGTTGGGCATGGCGATCCGCGATCTCATGGGCTTCCTCGTCATCTTCAA
CCTGATCTTCCTGGGGTACTCGGCCATGGGCAGCTACGCGTTTGGGTTTGCGTTGGAGGAATTCTCGACGATCGGCAAATCCTATGGCACGTGTTTCCAG
ATGCTCGCCGGCGAGATGGATTATGGACGACTGAGTCAGGCAAACCCGAGACTCGCGCCGGTGTTCATCGGCACGTTTGTCGTGCTCGTGTTCCAGATCC
TGGTCAACATGTTCGTCGCGATTCTCTCCGAGTACTACGAGGTGGCGAAGAACGACGACGGAAGCGAAGAGGACGTCGAGTACGATGTGCTCACGCGTTT
GCGCAACTACTTGCGTGCCTGTGCGCCAACTGTCGTCGCGAACAAGAACGAAGTTATTCGCTTGATCCCAAAGCAGGCCGTGCGATTGATCTCGACCAAT
TTGGTGGACCAGGAAGAGACCCGCCAGCGCGCCAAGAAACTGTTCCGTGGCGCCGTGTGGCGTGTCGTCGCGCTGCTGCGCTTTGGCATGAAGTTCGATC
GCCGCATCCAGTTCGGCGACCGCAAGAACCACGCGCACCTGGGCTCAGGCAACGAGAAAAAGGACAGCATGGTGACACACATCCGCCTGTCGGAGAACTT
TGACCACAAAACGATCAAGGAGATGATCCCGATCGGCATTAAGATTCGGCTGAAGGGCGACTCACTGCTCGGAGACGGTATCGCGCTCAAGGTGGTCCGC
CACAACAAGCTCTCGGTGGAGTGCGTCGTACTGGACAACGAAGAAGGAGCCACAAATGCAGGTGGGCGTCGCAACCCGAGAAAGCCGATTAGCTTGCGCT
CGCTGTCTGCGAGCAGCTCTTTCGATGAGAGCGACTTCGACATCGATCTCGCCGATCACCCACCTCGCGAGCGCGTGCTGGAGCTGCTCGGCGGCGAAAA
GCTCCGCATCCCGTGGCAGATCTTTGCATTCCACGTGTTCCGCAGCTTCCTGAAGGAGGTGCGCATGGGGCTCTTGCGCGCGATCAAGCTCTGGAACTAC
TCCAAGTCGCAGCTAGTCGACGACTACCACTTGGGACTTCTCTTTGAAAGTGTGCGTGCCGACGGCCGCTCGAGTCTTCGATTCGACGAAGTATACCGCA
TGCTGGACCTGTATCTGCGCAAGGACAAGAAGAAGAGCCTGTGCACGCAGGCTGAGGTGCGCCAAGAAGCGCTGCAAGTGATGTATCGGTTCCGCAAGTG
TCTGATCGACATGCCGTCGCGCGAAAAAGAGGGTCACAATTATCGTCCGAAACCCGTGGACACGTCGACAGTCGAGCTCGGTCAGCTCGAATACTTGGGT
GACATGCTCGCTCGCAACTGCCACGACATGTGGGCACTCGAACGACTGAAGCAGGGCTGGGTCTACGGCGCGCAGCGTGACGATGCGAAGAAAAAGCACC
CGAATCTGATCCCGTACAAGCTGCTGTCGCCGGACGAGCAGGCGTTCGACTACCGCTCGTCGCTGGAGACGCTCAAGTCGATTGTGTTCATGAACTACAC
GATCGTTCGTCTGAACCACTCGGGCAGCTTCCAGGACGCGATGTCGCTTTCCCGCTCGCCGTCGATGATGTCGGACATTCTGGATGGTCCTGGACAAGGC
ACAAGCACGAGAGCACTGTTTAGCAGCACGTCGAATGTTGGTGCTAGTGGTTCAATTGCTGAGAATGGTGGTGCTGAAACCAACGGTGTCGCAGAGACAG
ACAGTTGTCCTGCGATCGCAAATGCCAGTGCCAGTCTTACTCCTTC