Description :
From Genome Similarity Track
Location :
Scaffold_895:738- 12687
Transcript NameFunction/comments
g17648.t1hypothetical protein
g17649.t1hypothetical protein

Sequence
11949 bases(100 bases per row)
TGAACCATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGGACCGCGGCGTAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAA
GGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAATACTTCAAGATCTTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTG
TCCCAAGTAGTCTACTTTCCGTCGGCCCCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTTCAACCTTCTCA
CACAGCATGTCCCAAGTGATCGCAGTCACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGACGGTCTCGGCTCCGGTTCTGGCTCGCCTGAAT
CGAACACGTCGATCGGTTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCATACAGCGCGTTATCAATCAATCGCTGGTAGATCTGTGGCGCATT
TTTCAACCCGAAAGGCATACGCGTCCACTCGAACAACCCGAACGGTGTGATGAACGCAGAGATCTTCCGTGCGCGTTCTGTCATGGAGACTACCCAAAAG
CCACTTGCCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAGATCGCTAATCAGCGGCATGGGGTACACCATCAGTCTCGTCCAAC
TATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAGGCCCACGGTGAAGTTGACGGCGTGAT
CATCTTCGCCGATAACAGGCTCTTGATCAGATCCGACAGCTTCTCACGAAACTGTGGAGCGACTTTTCGGACACGTTGTGCAACAGGAACTGCTCCTCCC
ACATCGATGTCGCAGACTGCGCCAACGGCAGCTGGTGGTAACGCGTTCCCCTTCCCGATCAGGAGATGTTTCCGCCTCCAAATTATCTGTCGCAGGCGAT
CGATTTCTTCCGGGGTGTTTGACTCAGCATCGCCCACCTGGATATCCTCGATCGTGACTTCATCGGTGGTGGTCACTACTTCCGGCAAGATTGCCATCTG
TCTCTCCACATCTTCCGCGAACAGGTCGCCACCTTCGTGGTAACATACTTCTTCGTCATCCAGCGGTTCCGGATTAACGATCAGAGGCGTTTCGGCCCGG
GGCACAGACTCCCTCTGGTCCGCAGTCATCTCGTTTCGTGTGGCCTGCTCTATTGGCGGAGATTCTCTCGCGTCCTGATCGCCGGTGCCACCTTCCTGAT
CCCTTGGAGACCCCTCAGCTTCTGGTTTCATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCGATTTCGAGGTTCCGCGGTCACGACGCAGGAT
TTTCATCGGTGTGTCGTACTGAGGTCGATCTACCATGGGTCCGGTAGGAGCGAGTTCATGCTCTTCTACCTCCACATGGTCTGTAGTAGACTGGAAAGCT
AGATTCTGCCACTCGGCATCCCTGCGCGATCCAAGTAACACGAAACCGGGAGTGCGAGGTACGCGTCCTCCTTCAAGCCACATGCCGACATGGGTGTCGT
CTTGCAATACTAACTTCTGATCGCTGATATTCGTGATCTTCAGATAGCGAGTTTTCCCCAACCCTGTCACCAGACTCGGTACCCATTTATCTCCTCGAGT
AACCCACAGTTTCCGGTGGCTCGACAAGATGAAACCCTTCCGAATCTCGATCGACTCTCCGACTTCCAACTGGCAATGTTCTCCGAGCTTGACCTGCGTG
ACCTTCTCTCCGTAGAGTTGACGTCGGCCGGCTAGCTGAATACGCACTTCGTCTGGAAGATTTATTGATCCATCAGCCAGATCGAGGCGAATGCCAGCTG
GCACCATGAAGTCCATCCCCAGGATCAGGTCTTGGCCGCCTGTGGGCGGACCAACCCACGCGTCGAAGTAGTACACCAGTGATCCAGCGAGCGTGATCTT
GATTCTGGTACGTCCATCCGCCATATAGGGATTCTTACCAACCCCTTCACATTCCAACTCTTGACTGTTGTCTATGTAGCACCCAACCTTACGAGCAAAG
GCGGCATCCAGAATGGACACCTCGGCGCCGCTGTCAAACAGCAATGTGGCTCTTTCGTTGTTGATCTTCCCCATGGCTTTCGCCTGCCGGAATTTCTTGT
CTGGCACATGGTACTTCCAATATCCTCGCGACTCTCCGTGCAGGAGATCCAGAGCCATCGTCACTTCTGATCGCGAATACTCGTCGACTTGGTGGAGGCT
GGAGATCGCCATGGTACGTTTGTCATGAAGGTCACATGTATTGTCCGTCGGCCGAATCAGCTTACTCACCTCTGACTTCGACTGTTTTTCGACATATGCA
TAGATGCAGAACTGAGAACGCTCGTCTCGTACCGGATTCAAACCCGGCGAGCGTTCTAGTTTAACATCTTTTCAGCCGCTTGCGGGAGCATTCCACCGTG
CTTGGTGGGGTTGTACCATTGACGGATCAAGTTGTAGAACTCTTCCATCGGGCACTCTCCGGCTCCGTGAATCTCGCCGCAGGCCTTGCAGACGAAGAGA
CAGCGATCGGTCGGGTGGCCCTTCTTGCCACATTTCTCGCACGTCAGACGCTTCCAGCAACCAAGATCGGTGTGCTTCGACGATCCACAGTGGGAACATG
GCTTCCGCGGGGCTTCTCCCTCGAGAGATCTGGCTGGACGATCGAGGCGACGGTCGTTGGAGTCTCGACTAGGACGGCGTTGCTCCTGATCCGAATGCGA
TCTGGTCGGCTGATCGGGCGTTGTCGCGAAGTACACCTTGCGTAGGTCTCCCTCACCCTCTGATCCGCTGGTTTCCAATTCGGAGTCGCTCGAGTTGACT
GTTGCGCGGATTGCGCGGACTGCGCGGGCATTCGCGGATGGGGTGATTCCCGTGGGTGATTTCTGCTTGGGTTTGATGGACCCATACACCGTCTTTCCTT
GTCTCGCCTTCGCACGTTGTCGGGATCGCAGTGTCTCTTCGAGAGTCTCTGCGTCCGGAATTCTTAGCAGTGCTAGTTGGCTGGCTAGATCGCGATCGTC
GAGTGTTTCGATGAAGTGATCGACATGTTCACGGCGGACCTCAATCGATCCATCCTTGATCGAGAGCTGAGCTCGCAAACCAGCGACATTCAGACGGTGC
AGATATTCCAGCGGCGATTCATCCGATCGCTTTCGCGCATGGTAGTATTGTCTCGCGACAGACACGCCACGTCCGCAGTATTGAGTCTGGAAGTTCTTAG
ACAAGCTCTTCCAGTTGCCGCGCGTCGTTCGACTCAGCTGTCGGTACCAGTTACGTGCGGGTCCAGTGAGCAGATCTCCAAACACCAGACACTTCTCGCC
ATCAGGAGCTTGATCTCGGACAAAGGCAGACTTCAGTTTGCCGAACCAGCTTCTGGCACGATCTTCGTCGTTGTCCTTCCCCGAAAATTCCTTCAGTTCT
GAGATCGCGGAGACTCGGATCCTTGTGGCTGAGAGTGTTCCGCCGCCTGTAGTCCCAGCAGATGCGACTGCGGCACGAGGGGCAGCGTCGACACCCAGGT
CATCCGGATCGTATTCGCTCGGGTGCGAATGGTCCCGGCGATTCGACTCCACGGACTCCATGTCAACGTCTTGAGCTCCAGGTGGCTTGGTTTGGTCGAC
GACTGGCGTGGTCGAGACCGCTTGCTGTTCCTTCAGGAAACGCTCCATTGCTGCATTGAAGAACGATTGCATGCGTTCAGGGGAAGCTTGGGCTGGATCG
CTCGTCGCGATAACTGTCGGCTTGGTTTCCGATCTCTCCTTTCGCGACTGTAGCATGGCTGCTCCGGCCGGCCCAAGTGTCATCCGCTGCAGCTCGATCG
AGCTGTCCGATCCCGCTTCGGATGTGGCTGAGGCATATTGCGACGATCCGGTTTGGCTGCGAGTCGGTGCTGGTCTTTCACGTTGAACCGGGACGACACT
ACCGACAAGGGGCGTCAGCTTCGCGAACAGGCTCAGCGTTGATTCCCTGATGATTGGCAATTCCAAGTCGAATAGCTCGTTCGCGTCGAAGGAGCCGAGC
ACGATTCCCGCTTCTTTCAGCATGCGCATCAGCAGTTTCACCGCCTCGAGTTGGCTGGTTACTTCCTTCGGTGCCTTCACTGGACCTTGCAGTTCCCCAA
TTGGCTTCGGGCGCACGATCTTCATTACAGGGTCTTCGTGCAGGAACTTGTAAAGGTCCTTGTAGAAGAAGGCAGACTCCAGTTGCTCGTCCGTCCACGT
GTTGCAATCCTCCTGGTCTTCGGCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGGCTTCGACTTCTTCTTCTTCGAGGTTGCGTGCGGAACTGGA
GGAGTGGTTTTGGATGAAGGTCCTTCGGTTTTCACCGTCGGACCTTCGTCCGGCGGATCACGATTCGCATCGCGATCCGCGGGGGTCCCCGAAGGGACCT
GGGGAGGGGTTGAGGCTTTTCTTCTAGGTCCATCGCTGAACCTTCCTCTTTCACATCGTCAGAGCTCCTCCCGGCACTCTCACGATCAGTGGATCCTGGC
GCTTTCAGCGCCGTCGGCGGCGATCCTTCTTCCGTCGACGACTCGTTCCCTGGTTCCATCTTGATTTTGACGTCTTCTTCTGTGGACTCACGGTGAAATC
CCTGTGAATCACCAGAAGATCCGGGCACGCGCACCATTGTGGCGAAGCGGGATCACGAAAATTGCTGTCGTGATCTCCGGCTTACCAGCGGTACGCCCGG
ACTGCCGACTATCGGAGGGGGTACTCCGTTGATCTGGCGCGATCGGAACCTTGTATTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGT
GTTCACTGAAGGCGTCGGTGGTTACCAGGATGGGGTGGGGAGCTGGACGGCTCCTTCCGGGGAACTGGGGGGTGACGGCCACGCGGGTATTCTTCACGCG
GTCGTCGGTCGTCTGCCGATCGGGGCCTGGTGGGGCTTGATCGGCGTGGGGGGTGTCCTTGGGTGTGTTCCTTTACGTGCTTGCCGCCTCCTATGGCGGG
GTCTTCTGGGGGGGGTTAAGTGGTTGCGCACCTGGCCAAGCGATCCAGGGGCTCCCGTGTGATTACCTTGCGCGACGAGGTGAGTCCGAAGTCGTCAGGA
GGGCCAATATACTTCCCAACCTGGAATAAACGAACGCCACTTGTGTTGCAAGGGAAAGCTTCTTCTTCTCTTATTAGGTAAAACTAACAAGCAAAAAGCA
ACAATGACCTCAGCTTCCTACCTCCCCCCTTTACTGGATTCTTTCACCCATCTCCCGAGGTACCTTCCACAGATCTTTTACTTCCGGAATGATTGCGGGT
GTACCACCAAAGTGGTACGTCACGATCGCCATCTGCGATCGGGATCGCGATCGCAGTGGTGGCCACGATCGCATATCGAAATGATCGCACCATACCGCAT
ACCGGTATACACCGATGACTGATGGCGCCACTGTACCCATTGGGTCTCCATACCCCTACCCCTCAGGTCCAATTTAATCCCTCCAAAGTCTGCCTTCATC
AACCTCCGATCGTACGTCCGGTCCCGTCCGATCCTAGCCCATCGTTGGTCCATCACGAAATTTCCAACATCCACTTCACCACAGAGACCCGCAGACGAGC
ACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCATAGTGCAGGAGTGGACGTGGTCCTGGGAACAGACTTC
ATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGGTGCCCCTGGTGAAGTCGCAGAACCCAGCAGAGG
CCGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGCGAGAATTTAGGTTACCACGACGACGGCCGCC
TCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGGGGGCAGCCGACGATGGTGCGACTAACGAAC
GTGTCACCGAAGATTGCTCACTGCGCGAGAACACAATCGGTACTGCTGTGGTGAAAAAGGGTGACCTGCCGCAAGGGGATGGATACACTCGTTTGAACTC
CGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCACGCGGGAACGCAAACTCTACGAACGATGGTTGGCAGAT
CAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTGGAAGGCCTAGACGAGGGCCAGATAACGT
TCGCGAATAGGGGCACTGAGGAACCGACAGAACGAGACCGAACGCCGTTGACGACTTCGGTGCAACCCTCTGACGAACCCGTTGGAGATAGATGGGTCGA
CGAAGATGACGACTCGGTGGCGACCGACACCTCTGATGGCGCGGATACCACGTATACGAGTGAAGAGAACTCCATCCCAGTCCTCGGTGATGACCCGGAG
ACCCGATTGGACTCTGCCTTCGTAGCAATGATGCATGAGATTGCCGCGGGGGACGGTTCAGGTAGTGGGGACACCGATACCAATACGTCCGAACATTTAG
CGAATGAGATCGAGTTGACGGACTATGCACACGAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGTACTGGATTATTCAGGACCGAATGT
TCTGAACTCGAGAGCGACAGCCCGTCAACAAGAAAGTCTCGTTGCGGTGCTGAAACGACACGAGAAGATCATGATTGCGAGTGGGAATGCTCTGCCACCA
CCGGCCTACGGTGTGGTGTGCGATATTGACGTACAGGGGCATCCACCCATCAAACAGAGAGCTCGGAGAACACCGCTCCGACACCTTCGGAAGCTGTACG
AGCTTCTGAAAGGCTTGCTGAAAGCTCGTCTAGTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATCGTGCTCAAGAAGAATGGAGTTGATAT
TCGGTTGTGCATCGACTACAAGCTGGTGAATGCAGTGACGGCGATTATGGAGTACGCCATGCCGTTAGTCGACGACTTGTTGACCGACCTGGAAGCCTAC
CTATGGTTCTGCTCGCTTGATGCGGCCAGTGGATTCTGGGCTATTATGATGACGATGCGGGCCCGCAAAGTCTCGGCATTCGTCTGTGCACTCGGACATT
TCGAATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAACGAACGATTGACAATGCTCTGTGGGGTTTCGTCCAACCCAAAGGCGG
CTGGCTCCACTTCTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCGCGGACAGGGGTGACCGACCCTCCATCGCGACGACTCGAGGAGTCA
ACAACCCGGGTGACCAAATTCGAGGCCGACCGCGAATCCTCGGTCACGCTTGACGCAGTGAATGGGTTAGTGAACAGCCCTGTTGCCGACATGTTCTCCA
CCGGAGAACCGGATGAATCCTCGTTGGTGCCAGTGTTCGACCGACGGTCGTTTGTCGATGATATCTGTTTTGGGTCCGAGACTTTCGACGCGTGCCTGGA
GACGTTAGACCGTCTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGAGCATCTTCGTCCAGCCAAAGGTGGATTTCCTGTCACAC
GAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCG
GTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCAGCTTTGTATCAGTTGAAGGATGAAGACTTCACGCCTAGTGGCAGCCT
CTCGGCGGCCAAGCGAAGCTTCGCGGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTA
TTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGA
TGAACTACCACCCGGCCGAGAAGGAAGTCTTAGCGCTACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCG
TTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGGTCGAGCGACCCACTTCGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGA
GTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTTACACCGCCGACGA
AAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGAC
CGAAAAGAACGGTGGATACGGCAGTTGCTCGTGGGTTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTAGAGACCACCACG
GTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAA
TCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTA
CTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAA
TTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCC
AAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGACACCAAGCAAAAGCGAG
GAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGTACAGCCGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGGGT
GAGCTGAGAGCCGAGCAATCGAGCAATGAGGTAGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGTGATTATACAGGAAGAGCGCCGGAGACGAA
TCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTAAGCTACAGAGCAGCCAGAGACGCTTG
GAAGATGGCCGACAAGTTCGTGCTTAGCGAGGGTGGTGTACTGTATTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATG
CGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAG
TCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAGGTCCTGCCCCGACTGTAGTTCGAGAAAAGTCGACCACAGTTCCGA
GGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCC
TACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACTACCGCTCTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTA
TCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCA
AGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAAAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTAC
AGCAAGACTGGGACGAGATCGCGGAGCGATTAATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTG
GGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGTGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAA
CAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGGGCGAGGGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTG
CAGTACCGAATGTCGACGAAAACGAGACTTCTGACGAGTCACAGGTGGAGACGGGGGCAACATCTGATCCCACTGTCGAAGGACCGAGGTCTCTGTTCCA
ACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGTGTTGACCAAGAAACTCGCCCACCGATGGCATGGACCATTCAGGATCAAGAAAAAG
ATCGAAGAGTTTGCGTACGAGTTGGAACTACCAGACCGAAGTGGGTATAGGTTCTACCCGGTGGTGCACGTGTCCCGACTCAAGGCCGTCAACGAATTTG
GAGACCGACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGAGATTGGACTTCGATGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCA
GCTCGCTGGCGAATATGAGGTAGAAGCTATCCTCGATGACCGATCCCCGCTGTCGACGGGCACTAGCCGCGCTGTCCGAGAGTTCAAAGTGAAGTGGATT
GGGTATGACGAACCCACGTGGGAACCTGCCTCAAATTTATCATGTGGCGGGCTACTTTATGATTATCTGCGGACCCGGCGCAGCGAACGACGATTGCAGA
TGGTTCCAGTTGCTGATGAGAACTAATCTGGAGAGCTACCGAGAGTTGAACTGTCTACGGGGGTGATACAGCCCGTAGCAACAGATGAAATTTGCTACTG
TATCAAAATTGCGAGTGACCGACTATTGATTGCTACCAAGCCTCGGACGAGGCCTGGTTGCGACGTCGGTTGACGAATGAACTGCCTGCGGGGATGATGC
AGCCGCAGTGACAGACGAAAACTGCTACTGCATCGAATTTGCATATTTACATGTGACGTGAACGATTTTCGAATGGAATTGGATTAAATGGAATTACTTG
GAGCTCAAGAACTGCCGCTACGGAGGACTACGGGCTTCGGACGGCACACTGGCAGCTTGAGAAACGAACGTGAAAATTGGAGGGGGCCTGACCGAAGCCT
AGACCTCAGTGGTAGACGCGAGGTTGGCCAAAACATCCAGGTCTGACCCTTGGGGAGCGGCCGACGTGTTGCCGTGCTGAACACGGGAGTGACCAGAGCG
AAGATTCGGAGACTCTTCATTGCTTCCTCCGCTCGGTTGCGCCGGACGATCACGACAGAAGCTGGCCAGCCCATGGGGCCGTCACCATAGCCGACGACAA
GGATGGATCCACCATCAACCCAGACACCACCTCCGCTTGCGTCATTCCCCGAGGCACGAACAAAGGCACTTGGGGATTGCGCGGAGCAAACGTGGTGTTA
AAAGGGTGGCTAGCCGGCGCGTCGACCCAACAATTGCGCCATGGTTGCCTGTCATCCAATGTAGCCAATTCACCGAGCCAATCCTCTGACGCCGGAGCCC
ACTCAATCACCTCGAACGAGTATTGGAGATAAGTGGGCTCCAACAGAAA