Description :
From Genome Similarity Track
Location :
Scaffold_731:7378- 14041
Transcript NameFunction/comments
Phypl_g10618callose synthase, putative

Sequence
6663 bases(100 bases per row)
ATCTACGGCGCGCTGCCGGCAGGCGACTCGTACATTTGATAGTTCGAGTGCGACTTTGCGCGCGAGCGGCTGAAGTTTCTTGAACGCGCGCTGCCCGGCG
TGCGGGCGCTGCGGCGGGATGCCCGGATACGGCGCAGACGAgcgcgctcggcctccatctcgcccTTGGTGCACACCATGCCGTTCTTGAGGGTACCCAC
TGTGAACAGGAGCGCTGTCGCCACCACGCAGCATCCAGTCAACGCGAACAGGTACAAGTACTCGTCTCCGCTCATCGAATCGTTCGAGCGAATGTAAGTG
GCGCACACgggcagcaggaagaacaCCATGAAGTAGACGGTCACGTACACCGCGCGCTGCTTAGTGGCGAACAGACCGACGCACGACACCCATGGCACCG
AGGTAACACCCAAACCAGCGAAGaagtacagcagcagacccacGATCTGCAGCATCAGGTACTTGCTGTCGCCCGTCACGAACTCCGACTTGTCGTTTAG
GCCCAGGACAAACACAAGACAAGCCATCGGCAGCAACGTGCAGAACAAGATGCGCTTGTGGTCGATGCGgtccatgaagaagaacgagaaCAGCGCACCC
AGGAACTGTAAGGCCATGCAGTTTACGAACATGTACGTCGCATCCTCGATGCTGCGGAACGTGTCCGACAGATACATGTTCACGCAGCCCaggaagatgc
tggagaccAGCATCAGGAACAGGCCCATCATGAACTTGAGGAACGAGGTTCCGCTGTTGGCGCTCGAGTCGTCGCTCCCGGCCTCTTCATCGCGGATCAT
GCGCAGCTCCTCAGACACGCCCTCCTTGCGGCGCAGCACAGCCAGGCATCGCTCGCACGACTCCAGGCCCTCACGCATGTATACCCAGTACGGACTCTCC
GGGAAGATGTACACCGCTGGGGTCATGATCGACAGGATGATGGTTGCAATGAACACCTGCCACACCCAGCCCACCTcgttcgacgacgacgagaaccaAG
CAGCGAACAAGATGCCAAGAAGGAAGCCACTGcccagaagcagaagagcCTTGCCACGCATGTCACGAGTGGAAATTTCGTAGATGTACACAGCCAAAGT
AGGCAACAGCACACCCACAGAGCCACCGAGCAAGCAAATGCCAGGCATCAGGAAACCTTCGCCGCCCGACTGCACAGCACTCACGCCCAGCATGCCCAGA
ACCGTCAGCAGACCGCCAAAGACGATCGATAGGCGACGACCGATGAAGTAGTTCAGGAAACCAGCCACGAACGTGCCCACCATGCAAGCGAAGTAGAACG
CGTATGTGACCGATCCGTCGCCGACGTTGCCATTAAGCAAATCGTACGTCGTGACGTAACTCAGGAAACCAGCCGTGCTCTCAAGGGTCGTGAACAGGTG
GAACAGCCAGCCGCAGCCCATGCCGCCAAGCACACCCATAAAGGCGGCCAGCGAGAAGGCGTActgcgaagaagccgaaACAACTTCCGAGAAACCCTTA
TTGTACATCATGCGCGTCTGGATGATGTTCAGGAACGGAATAGCCGACATGACCAACAGCGGGATGATCATAGCGACAGAAAAcatgaagtcgaagaaga
acgccagctgctggagcatgCCCACGGTGGCGATCGACGAGTTTGCGAAGCTGTACATGCGTGCCATCTCATTGATGCCATACAGAGCAGCCATGTAGCC
GAAGAATAGAGAAATGGTTCTGGTAAAGGTGACGTCGAAAATGacgatggtgacgacgaagaaaaTGATAAGTgcaagcaccaccacgaacgtGTACAGC
ATCGCACGAAGCGACGAGTTCACGTTGCGCATGCAGCTGCCGGCAGCACCGAAGAGACCCATTGCCAAAACTGTGACAACGGAAGCACCGAACACCAGGC
CCACCGTGAGGATTTCCCACTCAAGGGCCACCACGTACCACATGAGCACAAAGTGGCGGCATTCACGCAGAATAACCGTGAAACGAGCAATCGGCTTCGT
GTTGTGGTAGAGCTTGAGCTCACCCTTCCACCAGCCAATCCATCCGCCAACCATAACcgtgtcctcgtcctggtAGTCCTCAGGAGCGTACATCCACTTG
GCCCAGGCCATCACATCagccttcgtcttctcccAGTCAAGGCCGTCTGTGTTGAAAATGTACGGAGACACCAGCCACACTACTGCAATAACCCAAATAG
CAAATGTCTGCACACCGAAGCTCTGCGACGTTTCACAGTAGTCGAAGGCGAACGAGTTCGTCTCGCCGGCAACAGAGGTGTCACAAATATCGAACTTACC
AAACGCCAAGTACACCATGCACAGACCAACAAGCTCCATAGCCTTGCGGTAGTGGCTCGGAGCGTAAGCCTTGTACAGTAGCACAAACGTCTCACGCGTG
ATCTTGAAGCCGCGCCCCGTAGCCTTGTACTGAGCCTCACCGTGAAGCAAGttgttgtcgaagaagtGCATGGTCGTAccgagctggaagatgaagaaag
cTGGACCAGCCGTAAACACCATCTCCAAGAACTGCACGAGACCGCGACGCAGACCCATTTCAGCGAAGTACACACAAATCAGAGGCAGCGAGAGAAACAG
ACCAGCCTGGATGTAGTACTGCGTGTTGTACACCGAGTCCATATCGTGGTACACACGGGTGTCAAAGCCGTAGCTCTCCGAGTTGTCCATAATGATCTCC
GTTGTGTTCATGTTGTAAACAATCTGCGTTTGCACGCCCGACAGGGCAATGTAGACCttgcagtacatgtacacgaaCGTCGTCACAATCGTCATCCACG
TGGCGTAATAGAAACCCGTGTGCGAGTAGTACATCGAGTTCAGACGGAAGAAGTCCATGAACTGGCCCATGCGATGAGCCTCACGCGCCAGCGAAGTTTC
ACCGGCACCGTTGGCCAGCTTACCTTCGAACATCGAAATCTGCGACAGAGCCACATCACGACCCTTACCACACTGCATGAACTCCACGTGGGTCACCACA
CCGCCACGAAGAGTACAGTTGAAACCAGCGAACACATCCTCAGACAGGTTAATGCCCTTGGAGGCCTTGGACACACCACCGCGCGtgatggccagcacct
tgtcgaATACGTCGGGGTGACCGTAATGCATACGCACGTACAGAGGATCGGCAAGCACACGCTGCGAAAGCGTAACGAACACAAGCTCCTGCCACGTCTT
GAACTTAGCGAGCGAACTGGCGTTACCCGTGAAAATGTGTTCACGCATACCGATGATCGACACAGGCTTCTTAGACGGGTGCAGGTCAGCTGTGCACAAA
AGCTGCGGCATCTTCAGACACTCCTCGAAGtagtgctgctggttcatATCAATAGTCTGCACAAACTCACCACGTGTGAACGGGATAGCGTTATTCTGGT
TCTCGGGTTTACCCTCACCCAGAATCGGGTCGCCGGGCAGCGAGTAACGGTACACTTCCACAATTTCATCGGCTTCACTCTTGATCAGCACAGTGTCGAA
CGACTTCTCGCCGTCCTCATGCTCTACCGTGTCCACATAAGCAACACGCAGGTTCGGAtactcgcgcagcaggtaGTCAATATCAGCGGCCTGGATCTTA
CCCTCCGCGCGATGCTTGCCGTACACCTGGCAAGCGCAAATGTACGAGAATTTCAGGCGGACCATATCCTGCAGCTGgttctgcttctgctcggcgGACT
TGCCAGGGCTCGAGCCAATCTCCAACCAATGCAGAATCTTGATCGCATCTTCGTACATCATCATACCCTGCACCGTACGGGCCAAAGTCTGCCCACGGTA
CGACGCCCACAAACGAATCTCTTCGGGGTGGTTCTTCTGAGCCTCCTCAGCAGAGCTCACATCAACACGCTCCAAAAAGTTGTCCCATTCCTCCTGGTGA
ATCTTCGTCAGGTACTTCAGAATCGTCAGGTTTTTGCCATCCTCCTCGACCTGTTGGAAGATCGGGTGGTTCACAAGAGGGTCGTTTAAGTCCTTCAGCG
AGAACAGCACTGTTTCGGCGTAGAACGGGGTCACAACCGAGAAACTGCGCATTTCCTTGATGGAACGCAGCTGGGGGATGTCCATAACAAGCGACTTCAT
GAAGAAACCAAGACGACGTTGGGCCTCCGTAGTACGCGGCATAGCCTCTGAACGGTCCAAAGAAAGCAGCAGACAGGCACGGGTGGCGGCACCCATAGCC
GTGTCACTGCAGAAAAGGTTGACAAGTCCGCGCGAAGCAAACATGTAGCCGTTAGCGCTCGAGCAGAACTTGGAGTTGCCGAACTTGCGCTGCAGGGCCG
GGTCTACGCAGAACGACTGCACACCGTTCAGGAAAGCCTCCATCTTGGAGACAAAGTTGCGGATCACACCCATGGAGTGCACTCGAGCGTTCGGGATGTG
CTGCGACTCCACGTCCGGGTCTGGGAGATCGAGGATCTCTTCCAGAAGGTCCActgcggcgacgcgcagACTTGCGAGCTCACGCACGTTGAACGACTTC
AGGAAGCCACCGCTAGCGGCGATCTCCTCAACCATGCGGAATCCATCGACAACATCAGCGTCGTCGTTACCGAACAGAGCACTGATCACGTACATGCTCG
CAGTGAAAAACGAACGGATAGCCGACAGGCAGTCATTCTCAACGAGCGTAACACGGAGCTGCGACTCGCCCTTACCATCCTTGGCCGTCTTGATCGCCAG
GCCCATGGCCTCCGTCAGCTTACCAGCCGACAGGAACACCGGCTCGAACACCTCGCCGGTGCTACGGATGTCGTACTGAAGAATAGCAGCTTCTTTGTCA
TCCAGCAGATCGCCCTCACGGAACGAGTTCACAATTTCATTCCACACCACGACGAAACGAAGCATCATCTGCGACTCGTAAGCCGCCGCGAGAGCGCTAG
CCCGGGTCGAGTCGGTGCCGGTAGCAGTGGCATCGCTTGAACGAGCAAGAAGAGTCACAACCTTCTGGTCGAACAGCTGCGGGGCGACACGGAAAGCCTT
GGTCATTTCCTTAGCACCGCGAATCTCGCCCGTCTTCATGAGAATACCCTGGAATCCACCGAGCAGAGCCTGGAAGATCGTGAAGTAAATCTGCGTGGCG
TAGTTGAAGATGAACACCACAGGCAGCCACAGGGCAATGATGATTCCAATGTTGTGGAACGACACCAGGGAGTTCTGGTAGTCCAGTGTCATGGCGTAAA
TgctcagcgtcggcagcatcAGCGGGCGCACCAGGATGAAGTACGACGCGATGGCCTCGACGATCCACAGGAGGATCCAGAACGTGATGTACTTGATCTG
GAACGAGAACGGGGGCGTCATGTCTTGGCCCACGTAGCAGCTTTCGCCCTCACGGACAAACTTGGCTGCGAATGTTCCGCTAATGACCTGGGGCGCGAAC
GCCTGCGTGAGTAGCACCAGCAGACCGGGCAGGATGTAAGCACCGCACAGCGGGTACaagttgtccagcagcgtcgtgtccttctcctcgttcagCGGCA
CGTAGATCATGACGCCGAACAGGACGGCAAAGCCGCCGTTCCAGATGATGCGCGTGGCCAGAGCCGTTCCGTACGTGAACgaacgcgagctggaggccga
gTTCTCCTTGGAGACCAACAAGTGCCATCCGTGACACACCTCCATCACGCACTTGAGGAAGGCcatcaacgccaagctgaacGGGATGGcgaccaccgcc
agcttcaagtcCCTCGTTGTGTACGGAtccacgacgtcgccaaTGCGTCCGAACTGAACCCAGCCGCTCTTGCCGCCGTCGGGCGAGATCGTGACGGCAa
acgccagcaccgtcagGAGCACCAGGAACATCATGTTGAACTGGAAAATGCGGTAGTAGTTGAGCACCATGGTCAGGAGGCTTCGGTGTTCGTAGAACGT
CTTGCCGTGGTTCTGGGTCAGTTCCTGGCCCACCTGCGTGACGGGGATGCTGAGACAGTGCGGCTTCCAGAAGTACTCGTTGATGTCGTCGTAGTTGCGG
ATCTTGACGTGCTCCAAGGGTTTGCCCAGCGCGTTCCGGCGCTTCATGTTGCTGGCCTCCCTCCAAATGGGGCGGACCACCTGCTCCAAGTACCAGCCTG
CCGCCTGCCGCTCGTGTCCCTGCGGGTCCGCATTCACCATCGTCAGCATCTGATGGAACAGGTAGCACACAGTCTCGGGCATGTGGCGGACGTTTGCCGC
CTCCCCCCAGATGAGGAAGTAGAGCATCACGTCCATGTGCAAATTGCCAGAAGACGTAGAGTGGGGAATGCCATTTCCAGTGTACGTGGCCGGGCTCGTG
TGGATAAATTTGCACCACGAGCGGTAATTGGTCAAGAGCTTGTCGGTCAGCTGCACGAGGTGGTGgtcggccgcgtcgctcgGCAGGCAGCGCGCCTTGC
CattggccagcagcagcagcacgtgctcgcgTTGGTTGCTCACCGACCCCTCCTGGAACCcgaacttggccttgaggAACTCGCAGCAGTAGTCGAtggc
cgcctcgtcgtcttgcgcCGCGCCCTTGGCGCTCCCGGGCGTCACGTCCATCGTGTTGAGCCGCTGGCTGAAGCGCGCCGAGCGCTTCGACTTGTTGCGG
CGCCGgtccgcgtccagctcgaagtagttggagctggcgcgccggcgccggtcCATCTCGCCG