Description :
From Genome Similarity Track
Location :
Scaffold_1040:7378- 11265
Transcript NameFunction/comments
Phyta_totarag11840hypothetical protein

Sequence
3887 bases(100 bases per row)
TCGCGCAGTCATCCGGATGGCCCAAAATCCATTGGCCATGTCAAGGCTCATGAATCACATTGCCTCCTCAAACCCGATCGACAAATTATCAATCAAGGGT
AGTGGATAATTCGAAAACTCAATAAAACCATTCACGATTCGGTAATCGATGTACATCAGGATGTCGatgccgttcttcttcagtacGAGGACAACAGGGG
AAGCCCAAGGTGATTCGGAATGTTCGATCAGTCCTGTTTCCagaagcttcttcagcaactcaTACACTTTGATCGTCAAGTGAGATGCAATTGAACGGGG
ACGCTGTGCCACAGGCTTAGCTTCATCCACGTCCAAATCGCACACCACtccgcgagctggagctggagctgcattCCCATCTCCGAGGAAGATGGACCGA
TGATACTTCAGAATGGCTTTCAGCTTTCGGTTTCCATCTGGAGACGATTCTCCGGGAACTCCAACGTCTTCCTTTTCGATATCGCAATTGAGACTTAGAT
CTTGGAGTTCCGGAAACATAGTGAGCTGGTCACGCAATTGTGATAACAACTCACTCCCTTCGTGAATGTAAACCGCAGGTTCCAAGTCGAGCTCTTCCGC
ATTCATCCTCACACAGCGTTCGTATTCCTTCTCGAGTTGCCGAGCCGGAGTACATGGCATCGCATAAATCGGTAAATCGAAAAACTCTTCCTTTTCGGAC
TCCTCATCTGAACCTTTGACTTCGTTTTGGACTATGTCATCCAGACAGTCTTCAGCCAAGCTGATTGAGTCGAAGAATTCATCACCATCCGAATCAACGT
CTTCAGTCTGACCTTCTTCTGGTTCCAATTCTTCTTCGAAACGTTTCGAATCCTCGTAATCTCCGTCGAAGCTCTCACAATCCTGCTCCTCTCGGACATC
ACTGTCGGGGATATCTTCCTCAGGACGCTCTGTTTCAACAGTCGCATCTGGCAGTGTTCCCGGCGATAGGTTTCCGTctggaccagcagcttcagaaaGA
TCCTCATGTGGATAATCCTTACATGGTTGCTCTTCGACGCCTCCATCCGGAGCATCTCTGTTGCCAACATCATCGTTCGAAGATCCCGTCGTCTCTAGAC
ACATGTTCTGAATGGCTGCCTCCGGAGGAACTCTCACTTTCTCTTTCGATCGAGTAACATCCAATTGCTCGGGTCTCTTCTGAAGTTGTACCATTCGAAC
CTCAGCTGTTCCAGTCGGGGATCTTGTCAGCAACTTTGTTGGCCACAAGTACTCCGACTTCTGGACGCAGGAAGGttcagcatcatcaagagCCTGGGCG
ATCCGCTCCTCACGCAGTCTAGTTTGCACTGAGACAGTATTTTCATAAATGAGTGTCTGCCATTCTTGATATCTCCGTAGTCCCGGACGAACGTATCGTC
CAAACTTAGGAAAGAATCCAAACTGAATAACCCTGGCGACTGCTGTTCCATTGTCTATTCAAACGTCCTTGGATGAAACATTCACTACCTTCACAGCAGA
GGGCCAAGACTTGGCAGAGTAGATGATCTGCGTTACCCAGCGGTCGCCACGACCAGCCCACACCACGTCGCGACGAGGACTACTATGTCCGTACCGAATC
CGCACGATGACGGGTTCTCCCGGACGGAGGTACGGTTTCTCATCTGGTCTGATCGGGATGTCCAGACCTCCTCTGGTATGCGCGAGATCTCTTCCAGAAA
GCAAAATGTTTTCTTCATCTGGAAGTTGCACAAGTCCTTCTCGAGCGCAAAGTCTCACTCCGGCCGAGTACATAAATTTCATGCCGAGCAACACATCCAC
TCCTTCACCGATATTCGCCACCCAAAGTTCCAAATGTAAACCACTCTCGGACCGGGAGTGACCTTCACTTCAGCCTTGGCAGTGATAATCGTCGGAACGC
CTCCCAATACCGGACACCCGGAGCTGTTTACAGAACGTGAGTTTGAGTTTGAGCCTACGCGCTAGGTCCGCACTCAGCATACTCACTGAAGCTCCGGAAT
CCAAAAGGATGTCGGTTCGACACGTATTCACTGCACCATGCACCATCGCAACTTTCCGATTCTCGTGATCTTCCCACCATCCATACCGCTCACCCGGCCC
CAATCCAAATTCAGGCGGAGCGTCTGAGTCAGGCGGATCCAACCGATGTCGTTCGGAAAGGTCCGTACTGAGCTCATCCGGAGGACAgtgttcttcttcg
atcaTGGTCATACATTGATGGTTATCTCGGTCACGATTCCTTAACTCTGGACCAACATACACTCAGACACACAAATCTGGGGTTGTCTTGAGCCCGGCGC
GTACTGGATCTCCATCCAGCGGTATTACAGGTTTAACGGTTTCTTCCCAGAATCAGCGGCTCGGTCCAGAAGTTGACTTGGGAGCGGGTCAGGTAGGTCT
TTCAGGATGCCTTGTTGGGCGAGGTTCTTCACAGCTTGGAATATCTTCATGCCCTCACACTTGCCGTCGTGGAATTTGTCGCAATACGGACAGGGTCGTG
TGTTGCACAGCCTAATGGGGTGTCCCTTCCGGTGGCACCGATCACAGACCAAGTCTGACCAGCAGTGCTCCGTCGAATGCGACCCTTCGCCACAGTTGTC
ACAATGCCGGGTTCGGCCTGGAGTTCCAAAACTAGGAGCTTGTGCATCCGAACGGAAGTTTCCACTCGAGAGTCTCCATCCAGAGTTTTCCAAAACACGA
TAAACTTCATCCAAAAGATCCTGCTTCCAAGGAGCGTTCCCTTCGGAACATTCTCCAGACGGCGCGTCCGCGTTCGAAGCGGACGACTTCGTGGATGCTG
TATCCTTGGTTGGCAACTCATCATCATAATCTTGGAAACGCACTTGTTTGTATTCTCCTTGTTCCGACTCGTCACCGCTGCTAGCATAGTAGGCTCGACC
TGAAGTCTTCGGACGGAAACGGTTCCGGGACTGATTGTCCGCACGGAAGTCGCGCGTTCGAGATGTAGGAGTCTCGTAGTCGTCATCCCGGCTGATGTCC
TCATGCTGCTTCAGGACGTATTCCAAATCGCTCAGACGGCGGATACGCTGTCCTTGTAAAGTCGTTTTGAATTGCGTGTCAATCAACTTCTTGATGAAAA
CCTTCAGGTGACGATCACGCAACTTGCCCGTCGACTTGAAGTCAATCCCAGCTCTGTCGGCAACCTTGTTCAGACGATAGTAAAATTCGTGAGGGGTCTC
TGACTTCTTTTGGATCGTGGTGTAGTACCTCTCTGAATCCGACGTCTTGGATTTGCAATAGTTCGCTCGGAAAGCCTTCAGGAACCTCTTCCAATTATGA
CGTACACTCGTTTGGAGCCTCGCTCGCCAATTTCGGACGGATGGTGGCAACTTCAGCTTGAACTGATAACTCTTGACAGTGTCGTTCCATCCGCCCGCCA
TAGCTATGCTCTGGAAACGTTCCAACCAGCGGACTTTGGTAGCCAGAGACGCTTTCTCATCGAAACCTTCCAAAGTGTTCGCGTTGACGAACGGGTTGAA
GGTAAACATCGTTGTGCCTCCCTTACCGGACGGTGTCGCTGTCACGTTTGGAACCGCAtcctcgaagaagctgctgtcggaaTTACTCGAGCTCCAATCA
TCGTCACTTGGATCCGAACTCGGGTCCGAATCATCCGATGGTTCATCACGGTGACGAGAAGGTTTCCTGAACGACTCCttgcgggggggggggggggggg
gggggggctggcTCCCTGGGATccttcttcgacgagttTCCATTTCCGGACGGACTTCGTTTGGAAGGACGTTTTCCAGACGGAGCTGGGTTCGCATTCC
AAATGCGGTTCCGTCTTGACAGTAGTGGCCGACTTAGCAGGAGTTTGGACAGCCTTTGCTTCAACTTAGTTCCTGGTCTTGGCCCGA