Description :
From Genome Similarity Track
Location :
Scaffold_172:7378- 10527
Transcript NameFunction/comments
Physo_144191pectate lyase, putative
Physo_144192Retrovirus-related Pol polyprotein from transposon TNT 1-94

Sequence
3149 bases(100 bases per row)
GACAACGCAGCTCTCAAGCGCATGACTGTTACCGGCAACAAGACCATCCGTGGCATCGGCAAGAGCGGCGTCATCAAGGGCAAGGGTCTCACGCTCAACG
GCAACAACATCATTATCCAGAACGTCCACATCACGGAGCTCAACCGACACCTCGTCTGGGGTGGCGACGCCATCTACCTCCAGGGTCTGGACCACGGCAA
AACCGCCATGAAGAACATTTGGCTCGACCACATCAAGGTCTCGCACGTCGGCCGACAGTTCCTCACGACCAACATGGCGAGCACCGACTCCCTGACCATC
AGTAACTCGGACTTCGACGGCAACACCGACTACTCGGCGTCGTGCGACGGCCACCACTACTGGTCGTTCATCTTCTACGGCGTGACCAAGTTCAGCATGC
TCAACAACTACATCCACGGCACGTCGGGCCGCTCGCCCAAGATTGGTGGCGACAGCGCTGCAAAGGTCGTCGCGCACGTCGCCAACAACTTCTGGGGCAA
CAACACGGGCCACTCGTTCGAGATCGGCGCCAACGCCTGGGTGCTCGCGGAGGGCAACTACTTCAGCAACACGATGATGCCTCTTTTCACGGGTAAGGAC
GGCGCGCTGTACGCGGCGAGCAGCCAAGACCAGTGCAAGAGCCTCCTGGGTCGTGCGTGCGTGGCCAATGAGCTGGTGGACAGCGGCGCCTTCGAGTCGC
GCAACGGCGAGACTGCGCTGAAGACGGTCAAGTCGGTCTCGACGTTCATTGAGTACACGCCAGGTTCCACTGGCTCGGGCGGTTCGCAGCAGCAGCAGCA
GTCCTCGAAGGCGGGTGGCTCTCAGCAGCAGCAGCAGCAGTCTTCTAAGGCTAATGGATCGCAGCAGCAGGAGCAACAGCAGCAACAGCAGCAACAGTCG
TCGAAGAACAACGACTCGGAGCAGCAGCAAGAGCAGCAGCAGGAGCAGCAACAGGAGCAGCAGCAGACTGCACAGACGAGCGGCTACAAGCAGGAGGAGT
CTCAGTCCAGAAGGCTGGCTGGCCAAACGAGCGACTTGGAGAAGGAGTGGCAGCAGACCACCGGCAACTTCGGTGTTGGCAAGTTGGACTAAGCGGAGCG
GAGCGGTGATGCCAAGAGTAGTGGGTCATGGAACATTACGCCGGCAGATTTTTTCCTTACCGTAATTTACCACCGAGAACATTCCTGAAACCTTCTTTCG
GGACAGCAGCGATTTCAACGACGACCCCTCTCGACCACTTGAGAGCGAGAGCCACGTCTTTTCGATACGAAGGTAGTTTTAGAACCGCTCAACCACTGAG
ATCTAACAGACGTTGATAACCTCTCGACCACCTTATAGTGAGAGCCACGTCTGTTGGATCTTAGGGCGTTTCTGTTGTCAAGACTGATGTGACGACGCCT
CGCCAAGCGACCGTGTGACGCGAACGCGTCATCAGTGAGGTCGGCGTGACCTTCACTGTGTTGTACCGCAATCATTCAGGTGATTACGGGACGATGACTA
CGTCACGGTGATTACGCCAAGATTGTGGGTACAAGATGGGCATCGACGTGGCGTTCTCTGATTGGATAAGGTAACTGTGTATCCAGTAGAGAATCCAGTA
GGGTGTATCCAGTAAGAGGTATCCAGTAGCAGGCTTAGAGGTAGCACGCGGTTGCGAACTAAGGACCTGAATCGAATCACTTTGCATTTTGCCAACTACT
GCTCAAGTGTTCTTCCTTTTGGTTATGAGCCCAAGCCCCGTCTTCCCTGACCAAGACCCCGACTACGCCTTCGCCATGGACGCCGCCCCGACCGCGACCG
CCCGCATCAACAAGTTCGACGGAACTAACTTCCACACATGGAAGTTCAAGATGCAGATGGTGCTGGAGGAGCGCGAACTGTGGGAAGTGACGAGTGGGGA
AGTGAAGTTCGAGCAGTGCACGACCGCGGCGGACCAAGCGACGTTTCGCAAGAAGTCGCGCAAGGCGCTGGCGATCGTCTGTCTCGCGTTGGAGGACTCG
CAGCTGCCGCTGGTGCGGTCGGCGAAGGACGCGCATGATGCATGGTCAAGCCTCGAGGGACACTTCGAGAAGAAGAGCCTGGCGAACAAGCTCTTTCTTC
GTCGACGGTTCTTCACGACAACGATGGACGAAGGTGATGATGTGCTGGAGCACATTAACAAGCTCAAGACGCTGGCGGAACAGCTCGATGCGGTCGGCGC
TCCGGTGAGCGAGGACGACTTGGTGATCACGCTTCTTGCCAGTCTGAGCGAGTCGTACCAGTTCCTCATCACGGCGTTGGAATCGCGTTCCGACACGCTG
ACGTTGGAGCTCGTGACGTCTCGGCTCCTGCACGAGGACATGAAGCGCAAGGAACAAGGTGGCGGTGCTGACGGAACCGCGCACGCTCAAGGTCAAGCGT
TCATGACAAGCGACAACGGGAAGCGCAAGGGACGGCAGGCGCAAGCGCAGAGGACGAGCGCCTGTCACTACTGCGGCGAGCACGGACATTGGATCGCCAA
GTGTCCGGTGCGGATCCGCGAGAACGGGGAGCGGCAGAGGCCGCAACGAGCGAACGTCGCGCAGGTCGAAGATGACTCTGGCGACTTCCTCTTCTCGGTT
GGTGGCGACACGGGTGCCTCCAAGCTGAGCGGCATGTGGCTGGTCGACTCGAGTGCGACAGCACATGACGTACTCGAAGGAGTACATGAAGAACTACAAG
AAGATCTCTCCGGTGGACGTGCATCTGGCGGACGACGGCGTGGTTCAGGCGGTGGGGAGCGGCGACATCGTGATGTCGATGCAGACACCGCGCGGCATGA
AGAAGGGTGTGCTCACGGGTGTGTGGCACATCCCGAAGCTGTCGCGCAACCTGTTCTCCGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGA
GAGCGACGGGTGCTTCGCGGAAACGAAGGGTCTCAAGTGGAAGCTCGGCGCTCGCGAAGGCAAAGGACTGTTCAAGCTCTGCATGACGCCGAGGACGCCT
GCTGACGAGGCCAATGCGGCAAGCTCGAAGAATCGCCAAGGGGACACCACGTCGTACCTCTGGCACCTTCGACTTGGTCACATCGGCCATGGTGGTCTCG
ACGCCATCGTCAAGAAGGGCTACGGCACTGGCATCCCAATGACGTCGGT