Description :
From Genome Similarity Track
Location :
Scaffold_1:737607- 748955
Transcript NameFunction/comments
Phyra_93354cryptic tubulin
Phyra_93355Hypothetical protein
Phyra_72796myb-like DNA-binding protein, putative

Sequence
11348 bases(100 bases per row)
AAGATGGCAGCCTGGTGGGTCCGCCAGTGCCTCCATCGACGCAAATGCTGCTGGCTGTGCACCATGGTCGGCACAGGCAGCTCCTGCGGCCGTTCCTGGC
GTGGAAACGGTGCGCTCAGGCGCAGCGTGAGCGAAGAAAAGTGCGTTGTATCAATATCGAGGAAGAATAGTACCGTATTGTATATCTCAATCGTGGCACA
CCTGACAATTGAGTGCATTGGTGTTTGTTATGAACAGCAAGTTTCCGCTGCTTGCCGTGTGGGTGCCGTCTTCTGCCAGCGAGTTTTCTGGGAGAAATGG
AGAGTTTTTGTTGATAAGAAGCGTCAGCAGAGACCAGAGGAGGAAGCGCCGAGACTTCTTCAGGGAGAGAAGGTGGCGTCACTGGAGGACGAATCTCTCA
GCAACATCAAAATCATCGGTGATTTGGAAGAGCGTACAGTGGAGAATGTTTCTGATGGGGAAGGAGGCGGTGATCAACATGGAGGAGGTGCTGCCATTTT
GCTGCGAAAGCGGCGCTACTTCAAGGTGAGGCGATACTTGGATCACGTTACCATGCTGTTTGCATTCACTGTTTTGATATGGCGAGCTTTTTTGTTGTTG
TTTGTATTTCAGAGGTGGAATCTTGCGGTTAAGGTAGATGGAAGAGACACTGGGAGTTGGGGCAACGGAGTTGTGCGCATCCGTTCGCTACACGCCATTC
GGCATTGGCGCGGATTTGTGCGGTTGAAAAAAGACCGCACAGTCCAACAGCAGCGCGCTTATTTCTTTCTTTACTATTGGCTGCTTAAACGGTCGTTGAC
TAGTCTTGGCCAACATTCATTGATCAAGAAGCGAGAAGGCACGCTCACAGTGAAGATTGTGAAGGCGAGCAGGCGGCGTATGCTGGTCAAAACGATGAAG
TTCTGGCGAATGCGACTTCGGTTGCACCAAACTCTAGCCTTATGGCGGAGTTTCGTGCGACAACGACGACATCAAGCGCTACTATACCGACCGGTAGCAG
ACGCATTAACCAGAAAAACTCACCATCGCCTTCTCCAACTTACATTTGGTGCCTGGGAGAAGCAGCATGCTAGGAACGAAGCACAACACATGCTAGTCAA
TGTTATCGACCGACAGCTGTACCGTAAAGTTTGTGAGAGAGCGTGGCGAACGTGGAAAATCAAGGTACGCCAGATTATCCAGCTCGACACTTTTCAGCGA
AGTTACCAGGAACGCAGGCTCCGACGGTTTTGGGAAGCATGGAGTGTGCGGACGCGAGAAAAGGGACGCCAAGAGCAGCTACGGCGTCAAGCAGTCCGTG
CCTGCTATTTATCACTTTTGCGCAAAGGGTTCACTGGATTTCGAGCTTGCCGCGACCAGCGGCAGCTTAGATTAAACCGAGTGGAAACTATGCAAGATGC
AGCAGATGCCAGACTTATGACATCAGCTTTCTCACACTGGGACCATTTCACGAGCAAAAAGAAAACTCGAGCGCTCAAGTGTCAGCGTGCCCTTCTTCAT
TCTGAATCTCGTTTGCTACAACGTGTTTGGGCAAATGGCTTCCGGTGCTTCTTTTCCAGAGCGTTGACAAAGAGAAGGCTACAGCTTGCTGCACTGGAGC
AGTATACCACCAGAGCGGTGAGATATAGCTTTCGTATGTGGAAAGATGAATGGCAAGATGAACGAAGCCGTGATGACGTTTTGAACAACATGCTGCAAGA
TTACATGCTGGCAAAACATCGAACAATAAAATGTGGGGTATTGGAGAACTGGTCAGAGTTTGCTCGAGCAAAAGCTGCAAATAGGGTTGTAAATGTCCAG
GTCCGAGGTTTGGCACAGCGACGTATTCTTCGGAAGCACTTATCCCAATGGATAACGTACATTTCACTCCTCCGCTGGCAGCAAATTACGCGTGCCCGAG
CGGAGCAACACTACAAAGGTGTGATTTTGAGGAAATGCCTTGAGCGGTGGCAACACAACATTATTTTGCGCCGGCGCTATCGCAAAAAGACACGAACGGC
TTTAGTACACTGGAAATTGGTATTGCAGTGCAAGGTATTTGATGGCTGGAAGCAGTACTTGCAGTCAAAAAGGGCAAAGCAGCAGCGAATACATGAGGCG
CTCGAGTTCCGCCATCAACAATTTGTTCGCAATGGCTTGCATCATTGGATAACCGCTGCGATGAACTTGCAGGAGCGTCGTGAGCAGCAGGTAGCACGTG
CTCAAGCAAGTAGCACGACGCAGGTTTGGCACCGAGTTGCAGCGATAGCTCGTCACTGGCGCTACCTTGCCATTCGACGTCGAACTATCAGCGATCAAGC
ACAAGCTCCGGAAAATCCTAGAAGTGCGTTCCGACCTCAGGAAGATGAATACTGGCCATCTGAGCGCCAACGAACAGCACGTGCACAAGACATGCAGCCT
ATGCTGTTACCTCCTGATGGAACAAGCAAACTTAGACGTGGAAATATGCTGTCTACAGCAGTTGAATATTCCAACAGGGCGAATGAACGATCCCCTTTAT
CCGAGTTTGTGTTGCTTCCGAGGAAACGACCGCAGCCTCGAAGACCCGTCGAAGTTTTGATTTTTGCAAATGGAGAAGCAGACACAGAAAACCTATCAAG
AGCAAACGAAAACGCCTATACAAATTCCCATGAAACCGTACGATGTGGGTTTGAGTTCCCTGTTGAGCCTTTTGCTCCTCTAAGCTCGCCACCCAGAAAT
CAAGCCAAGCCACCCAGTTCTCCGAGGACTTTTTTGCCTGCAAATAATGACTCTGGCAGAATGTGCTCAAGATTCTCTGCTCCTGTGATGCCACCAAGAG
AAGATAGCACTCTGTGCCTACCCAGTATAACCGCGAAGCGGCTGGACGCTTTGGAGCGGCAGCTATTAGCATTATGCCAGCGGAAAAAGGAGTGGAAGGG
GTTTCAGCGACAGCTCAATGCACTGCGTGAAGAAGCTGACAGAGATCCGCGGATTCAGTCGAAGCTACGGTTAGTTGAAGAGCAACATGCTGTACGCACA
AACCAATGGCTGCGTACAAAAGGAAGAATACGCTCACTGGCAACGCAAATCCAGGAACTGCGAAGTGCTTTACAGAGATAATAATGCCAAAAAACAAAAT
CTTCGCTCCACAAACTAAATCATCGAAGTAGGGTTTCATATTCGCTGATGAGTGCAGTGCACTTGTCGAAAGCTGCCTCAAAATCTGCATCTTCTAGTCC
ATGCTGCTTATACCAGTGTACGTATGCGTTAGCATGAAGCTGGCGCTGAGCTCGCTCTAAAAACCGCTTTGTACTCGTTAAGAAAGAGCCATTATTCAAG
CACAGCGTTGCAGATGCTGTCGCCTGCAGCGATGAGAAAGGTGCGGACCTAGAGTACGTTAGCGTTGCTTGCGGTGTTGCTGTTAACCATGGCACGGGGG
GAAACGAAGCCTGGACGACCTCACCAAGCTTTTGTGAAAACCGATCAGCTTCACTCAAGGCTGGATAGAAGCCGCGGACAAGTGTACTCGATGCCAGAAT
TGCATATGAACTCCGTGAAAAGGAAGCTGCCGTTTGCTGCACAAGCGTCTCTATCGTGTCAAGGGATGCATCAAAGTCACAGGCCCGGTCATGCCGGAGA
GATAGCGAACGCGCCTGGGCGACCACCGGAGCATGAAACAAGGTCGCAGAAGTAACGCCTCTCGCAACTGATGACTTGGAGGGAACCTTGCTACGTATAC
TGGATCCAATGCGATCTCTCCACACACCCGAACGAACGTCAAGCATCTTGGCCGTCGGCATGGGACATACATCAAGTAGTAGTTTGCCGAAGTCAAACGG
CCGAGAATAAGCACCATCTCCTTCCCCAACCGGAAACAACAACCCCGCCAGATCTGCAGCTGCCATGCAGTTAATTTCAGCTAGCGACACACGCAGGTTC
GAGCTATCGGTTCCTGCCTTTGCCTCCTGGACGATCGCCTTCCAATGTGCCGCCGTACGCAACATCTCGTCATTGTCCTTGTAAATCACAGCATCTGCAA
CCTCCTGCAGACATCTCAGCGTCAAAACAGCATTATAATTCTGAAGTGGCGAGTCCCCGCGTGTGCAGGACGGTGCAACTGATGCCGTCACGATGTAAGC
CTTTGGGTATGTGTCTCGCATGCGTTCCAGCACGCGACAGCCCAATCCCGACCCAGTGCCTCCTCCCAGAGAATGCATCACCATACTTCCTTGGTAACAA
TCCACTGCCTCAATCTCACGACGTAGTGAGTCCATCACGAGCTCCACCAGCTCCCTGCGATCATCTACAGCCAACGACGTGAAGGCTGGCGCTGGGGCTT
TCAATCTCGGTCCGTAGTAGCCCATGGCCCAATTGTTGCCTCGTCCTGCCTGTTCCACGTGCGTATGAGCCGGCCGGAACGCTCCTACCCCTTCAATTTC
ACTTGAGCACACAGAATGGACCACTTTAGGCTCGGTGTCCACGAGAATACAGCGAGCAGCTCGGGTCGACGGGTGGAACAGGTATCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGGTTGCCGCATTGCCCGATATGCACATGCACACTCATATGTGCACATGCAAACTC
AATATAGAGATCAAGCACGTGATTGGTCAAAACTACGTGTTACTTCAGATATGGAGTGCTGGTCACGCAGCTTTCGGACCAGTACGATGGCGTCCACTGC
GCACGATGCGGTGCCGTTCCAGGGACGCTTCCCGTCCTGGGAGGCCTTCGATGTAGCGCGTAGAGCTCACTGCGAGAAGACGTACACCATGTACGTGTGC
CGCAATTCTGTCAAAGTGGCAGTGGCCAACAGGCGCCGCAAACTGCAGGTGCCCGACACTTGGGTCTACGACAGGAAGGTGCGTCCACCTATCATCAAAA
GTGTTTACATGCCCCGATTCCTTTCGATTTATGCGTGATGCCGTCTTTGCACTTGTCCAGATTTATGTGTGCACTCATGGCTACAAGCGGGTGTCGCGGT
CCGGCGGCTCGCGGCCACGGCAAAATGTGCGCTACACCGACTGCAAGGCTCGGTTTACTGCTTGCGTGACCAGTGAGCTGTCTGAAGATGGACGAGAAGT
TCTTTTCATCAAGGCGACGGGCCAACACTTAGTCCACACCGATCACCCAGTGACTCTGGAGCAGTGGCGCATGTATTCGCAGAACCGAGCGGCCGTGATC
GACCACCCTTACCTCACGCACGAAGCTGAGCTCATGCGTCGGATAGGATCCAACAAGAGAGTTGCGCGAGAGCACATTGAGACATTGACGGGCAAAGTGT
GTACTATGAAAGACATGCACAATCTGTACGCGCGGCTCAAGAAGCGAGAGAATGGAGGGAGCCCTAAGGACGCGTCACGTGCCGACCCACAACAAGTATT
TACCGGCAGCTCTCTCGAGCTAAATCGCTCACAGAACGCGGGGAGACAGCTCAACAGCGGTGCGAGCGGTCAACGGGTGGAGCCTGTCTTGCAACGCTTC
GTGGACGCTGATGTGGAGAACCATGTGAGCATCTTGTCAGGCGACGACGGCTCCAACGAGGCGATTTGTCTGGCCAGTCGAGCGATGAAAGAGCACTTTC
AGGTCTTCCCGGAGCTGCTCATCCTGGACGTTTCCATGGTAACGCAACCAGACGTGCAACCAGGACAGCAGTTGCACGGATTCTTGTCCATGGATGCACT
GGGCAACGCTAAACCTGTTTACGTGGTGCGGTCGCTGGCCATGTCATCGTCGTTGATACGCCGGGCGTGTCAAGATTTTAAGAGGACGCATCCGAAGTGG
GTGGAAACAAAGGTGCTGGTCATGAACAGACTATTGCCAAGCGTTATACATGTACTGACGCGCGAGTTTCCACATGCTCAAGTGCTGTTGTGCCAGTTTC
ATGTGCTTCGGCTTCTTAATGAGCTACTAGCGGACCCCCAGCAACAAATCCACACCCAAGTTTCAGGCGCTCCGACTGCAAAAATTCGCCGAGCACCCTC
AGATCGGGATGAGCTCCACCAATCGCTCCACCAACTTGTGTTCGCCCACTCCGACTCGCGATACAACGAAGCGAAGGCTTTACTCGTGCAGCAGCTTTCT
ACCGGAGAACTGGTTTCCATATTCGAAAGGAATTGGGAACCCTATCGAGCGCTGTGGGTATCTTATGCTCGCACAGAACAATTCGACTTCTCATCCTTCT
TTACGAAGGGCATGAACAGTTTTTGGGAGCCGATGAAGAGTTCATTTAGCCGCACAAGAGATAATTTTCTCAGTCCAGCAGTCACAGACGTCTCTGATTC
CTCGACGACGATAATATCCACCCACCCACCAGCACTCAATGTACCGTTTCAACCTGTGGTGAGTGCTACTGACAACCAAATGCGTTTACAAGCATCTAAC
GAGTTGGGTGTAGTCCCCTTGACAATGGCACTCCGTACGACGGACTCGATGAGAATTACTAGCGGCAACTCGCTGGCCAAGTGCACCGCTGAGATTTTGA
CGATGATGAAGTTTATTGAAAGTGAGTGGACGTCCAGGATGCTGATTCTCGAGTTGACCAAGCCTGTAGCAATGGATCACTGCGACCCTCTGCTGCATTT
GATGATCAACTGCCTAAGCAGATTTGCTGTGGACCTCGTCAGCTCGCAACTTACCATTCTGAGCGCACACGCCAGTGGGTCTGTGGCTGTCACCAAGTCT
CGAGCTGCAAGGACTCACCAGTGCAGCAATAACACCGGAGCTAATCCAACTCCTGCCTCCCCAGGCCCGCCAGTCTCAGAATCGACGGTGCGTTGGCTGA
ACAAAATGACTCGTGAAAAGCACATCCTGCAACGTGACGGAAGCGGCTGCGACTGCGATTTTTTCTCGCTGTACCAGCTGCCGTGTCGCCATTTGATTTG
GTATGAAGTCACTGCTCTGCAGAGCAAGCAGCTTAGTGTGGTCGCAGTGGGCCGGCGGTGGTTTTTGCGCTCGTTTCGGGTATCGAAGTTGGCCAGCCAG
CGTGAGTCCAACGAGATCGAGTACCATTTGCTCTGATGTTCGGCATCGACAACTAGATAGACTTAACTGACAGCGCTCGCAAGAGCCTTTCGTTGAGTAA
ATCGCAACCTCCTTGTTCGTGGCTCTGCTCATATCTAAACGTTCCTTTTGCCGTACAATAGATGCATGATCGATATGCGAGGCTTTGCCAGGAGCTTTAT
CACCTGAAGATCTCCGACTTTGCGATCACCGAAGAAGGGTCCATCTCCTCGTCATCATCAATCGACACGCAAGGTAATCAATCGAGATTGGTACGTGGCA
TGTCGCAGCTGCCCATCTCACTGTACGTGGCGGGTCCAAAGAGTCGGCTGCGTTGCGGAGACCGCGCCGACGGTCGCTCCAATCCAAATGTACTGGCGGA
ATGACCGCTCGAACGCGGGGTTCAGAGCTTGTTTTCGCTGCGTTGCCACGATCGAAGCCCGATGTCGTTGTTCCGTTTGTGCGGCGCCAGTAGGCACGCA
TCGTCGGAAAAGTTAGTTGAGAATGTCTGGTTGTCGCGGCGCGTTTCGTTGATCCAAACGATTCGATCGCCAAGCGGCCGCAAAGACTCGCGGCAACGAT
GCAGATTTAACCGTAGAATCTCTCGAAGCACAGCACCGCAAATTGGTTGCCATGGCCTCGGTTGTTCGGCGGGCTCCATTGGAAGACGTCCGCCGAGACT
ACTGCAGAACGCGAATATCTGTAAACGAAGCGAGCGAGACGTGTAGTTGGCGGTGACGTTGCTTTGCACGTCATCGCACGAGACGTTGGGATTTACAGCG
CAGCTCGGCTTTTTAAAAACCTGCCCCAGCAAGCACTGGCCAAGCAGATCATCCAGGCAAAAACGGAGCTCGTGTCGCAATGGAGAAAGTCCCCTGATCG
GTGCTTGCTTTGGCATGACCGAGCTGATCGGCTGTCGACGCTGGGCCCCAGCCTGGGGGGCCCAGTGGGTGGGAAGGAAATCACTTCGATCCGCTGGGAC
CACGAACTTCGTGTACATGTATGTAGGTAGCGACATGTCGGCAGCCGATCACTCCCTTGATTGCGCAGCTGCCCGCTCTACCGACACTGTACCGACATTT
GACATAAATGCCAACGTAAAATGCCGAGCGCCGGTGGTCATCGCTGTAACACGTGCAGCCTGCTTAGCGAGCCGCGCATTGCCACGCGTTTAGCGAACGG
AAGAAACAGTTGAGGCATGCTTTACAGGCAATTCGCTGAGCTGTGCAAGCTCAGTTGGTTGCCTGGAACACTGCAAGTGAATCACGGCGAGTCAGCTGGC
GGGGTTGACGTCAGCGGCTGCAGTGCAAACTGTTTTTTTAGATAGGGTTGTCAATGACAACTTGCCATGCACCGGCCAAACAAAAACCACAACACTTGCA
CACATACTCCATTCAGCTTCCGATGATATTTGCGGGGATGCCTCCATTGCCCGCACCGATCCAACAGCGATCTGGCTCCAAGACCGCCGACGACAAAATG
GAGGCGGAAACGCAGATCATCGGAAACTCTGCGGTGCCGCCAATCGACTGGGCAGCGCAAAGTGCTGGTTGCAAATCAGCAAACAACTGGCAGTGAAGGT
AGAGATGTATCTGGGACACGCAAAACTGGCACCTCGCCCGCGAGCTCCAAATTGGAGCCTCCAATACGCGCGACTGGAAGGATCGTTTAGAGCCCACCGA
GGCCCGATCCGAGCAGCATTGGCGCTGCTTCACCGGCGACGACAACAACCTGAGCGGGCAGAACCCCAAGGACTGGCCGCGCTGCAGGCGTGTGCCGTCG
TATTAGCCAGCCATTTGCGTTTCACAAAATCTTCAGAAGTGCATGGACCATGATGCCCTGAGCCCAAAATACCGCTGTTCTGGGCTCCCACGCACTTGAC
TGTCAGTGCTGCGAGCGCCATAAGCACCGCACTGCCCGCGCTATCGACGCGTTCTAAACGGCTGGCGGCGCGCAAATGTCTTCACATTTTTCGACACGGC
CGCCGTGGCGGTGTTGCTGTTGAAGCTGTCATCCGGCCCATAGAAACAACACGCTTCGTGTGCAGGCTCGAGATATTCTTCCGGCGCTGCCACAGACTTG
CTACTTGTATGTTGCCATGGCCGGGCCGGCCACAAGATCGCCCAAAAAGTGTATTTATGATGACCCGAAATAGTCGACCCGCCCGGCGCTGCACGTCGCC
GAGATGATCTCAAGTCAACGGCAATTGATTCTCGGGTCCGCATTGCAATCGCCGTTGACTTTGGGCCGCGACTCGCGAGCCGAGCCGAGGCCAGCGCATA
TATCGTGGCCATCCTCACGGGCTCCCGTGGAGGACGGGGCTCGCAGAAAACACCTCCGATTATGAGCCAGCGACATGCTCGGATATTGTACGCTTCGCGA
GAAACTCGCTGGGCTTGTCGATTGCGAGCGCTGGCAATCTATGCTGCACCATCTTCAAGCACAGCATGGGCGTCATCGCTACAGCTCGCCATCCCCGTTG
CGCTCGAGCGGGCGACACGAGCAGTCAAGCCGCTTGCTTGCCCACGATACCGTAGCTTGCTTGCACTTGGGCAGGAAAGTAAGTAACTTCTGGTTAATCA
AGCTGGGGTTGTTGCCGGCGATCGCAGGTCGGGTTGTCCGCCCCGGGCCTTTCCCTTGAGAGCCCCTCACTTTTTCCTCCGCTCCAGTTGCAGCCCGCCG
GACTTTTGTGCGGGGATGGCGAGCGCAGGCAACTGTTCGGCCTCCGTGCCACACGTCAGCGAAGACAGCGACTCGCTGCCAGTGAGCGAGCGACTGCCGA
GCAGAGCACTCATGCTTTGTTTTTCTCGCACATAAGCGAAATGTCGGTAGGTCCCAGAACCGAGCCACAAGGGATTTGTTTACTGACCAGAGGGGATCAA
CCGACATTGGATGTGCCGACATGAACGGAGCTGTCATTCTCAAATTCGCCTCGCATCGAGTAGTACGCGGCAAAGCAGCTCGCTAGCAGTTCCTGTTCGT
GTCAAGCCCCACTTCATCATGCAGATGATTGGTGCCGGATCAAGTTCGCCGTTGTCGGTCACCAAACCCAAGGCCAAGTCCATGTCACCCACAGCCAAGG
GTATCTGGTCGCAGGAGGAGCACGACCGCTTCCTCGAGGCCATGAAGCTCTACCCCAAGGGCCCGTGGAAGACCATTGCCGACCACATCGCCACGCGCTC
AGTGCGTCAGGTGCAGACCCACGCGCAAAAGTACCAGGAGAAGGTGTCGCGCCGCCTGCGTGGCCTGCGCAAATCCAAGAAAAAACTCGTGCGTCCCGAG
CACCGCATCGACGAGGACACCATGGAGCTCTGCAAACTGGTGGACTGCGCTGCCGAGAAACTCGTGGCAGCAAGTAGGAAGTCGTCTTCGCGAGCAAGTG
GCGTCAAGCTGGAGCCGCTGCAGAAGAAGAACGTGGTGAAACAGGAGCCCCGCGAGGCCCACAGCAGCCCGCGCGGCACCGACGTAGACATGAAGACCGA
CGACTTCTTGCCGCTGCCGTTCCTGGACTTTGGTGATGACATCGATCTGGACCCTGTCCACATCCCGACCGTGAGCGAGTCACTAGACTTCCTGATCGAC
TACCTGTCGATATAATCCTGCAGCTGAGCACCAGTTGCTGTTAGTGCAGTAGGCGATGGGGTAGACCCGTCATACTTGGTGAGGTATCCGCGATCAAGCA
CGCCTTGCAGAGGCGGTGACTTCATATTTATATCATAAAGGGATTGCCAATACAAGCCATTATCGGTGGGGGCTTGGAGCGGATCGGCTTCTCGCCACTA
CAGCCCCCGCTTGATCCTTCGACAACGGTGTGCCCACCCTCGGACCGGGGTGTCATTTGCTTGCAGTGCAACCGAGATGTGGTGGCCTCGCGTGCTGGTC
CAGTGCACTCTTCTTCCTTGTCATATTCGAGCTTGATCAAGTTCAAACGAGCACATTCGATGGCGCCAGGAAGTGCCACCACTGTCATGGCGATACAGCC
GCGCAAAAACTAAACAACCTTCGTTTCCTGCGGGCCAAGTGTCTTCGTGGAGAAGTTCTCCAGGGCAAAACTCGAGAGAACTGACGCCACGCACTACAGT
GTACATGTATGATGCCGGTGCACGACACACGGCTTCAATCGGTGTTGGAACGCACGCCGGCTTCCTGATCCTCGCCGATGGGCAGACAGCGATGCACTAC
GGTACATGTATTTAATACTTCATGTATCCGTTGGTTGCCACGGCAGTCTCCTTGCTGCAGCATGCCTAGACTGCTGGCTCTAGCGCCTCGACGCTCTTGA
TCGAGGAGAACACGATCGAAAGGCAGGATTTCATGGGACACCAAGACG