Description :
From Genome Similarity Track
Location :
scaffold_289:7376- 9721
Transcript NameFunction/comments
Pl_106520hypothetical protein PHYSODRAFT_521725

Sequence
2345 bases(100 bases per row)
ACTGCCCCAACGTCCTAGAGCGCCACCTCCAACTCCACCTCCACCGGGGCTGCCGTCTTCTTTTCGGCCTTCTACGTCGATCTTAAGCCAGCGAGTGGAA
GTACCGCTGGCAAAGTCAAAATCCTGAATATGTCGAGTACGGACTCGCAACAATGGAGCAGGTGTCATTCCACCTCCATTAGCATCGTTTGAGTCGCCAA
AGCGCTCGACATCATCCAGTAAATGAAATGAAAAGGCACTAAACACCGTGATCAAAAACCGACTTGGACGTTCAGGTGACACGTCGATCTCAATGGGCCT
TCCTCGTGCTTCAGCCGGTCGAATAATCAAGTTTGGGTTGCCGAGTAATCGATGCACCACGAAATACGAGTCACCTCCACTGATGGTACGTGCACAAGCC
TGTAGTAGTGCACTTACCGCTCGGACTCGCTCCTCTGGGGCAGCTGCAAACCGTTGAATGTGTGCATCGAGGACCTCGAAAATGTGCTCAAGACCACGAC
TCTGCTGTGGTTGTCCTGCTGAATCAGAAACGTTATCTTCAGAAGCTTGTTGCTGTTGCTGTTCACCCCCACCGTAAAGTGTATCATTGATGAGAAACAA
TTCAGGAAGAATATCGCGCAATGTCTGCTCCAGTGAGATTGGCTGGGGTCTGGGCAAGAAAATTTGAGCGAAAGTCTCGGCATGGCGCGAAAAGATAGCC
AAGTAGTCACTGCGCGTCCGTGCTCGAGCAGCCTTCTTGCGAATTGTAATCTGCTCTGGTGGGTGAATTTCCCACAACAATGGATCAGTCTCGCGTAAAT
ACTGTACGCTTCCAAGTTGCTGGTAAGATGCCTTCCACCGTGCTGTTGTAGTTCGCAGATCCTCAGTGTTCGCATCTTCCACGTCTCGCTGTGCCTTATC
CGTTGACAATGAATGTGAAAATGATGCAAGAGCCGCTTTAGTTGCTGTCGGAGAGCGAAATCGATAGAATGGGGTCTTGCGCTTCTTGTCCGGTGGTGAA
AAGGGTCCGAAGGACGAAGACGAATGTGCTGGTAATGTTGAAGAAGACCCTGCAGTAGCAGATGCTAGTTTACAATAGAATGACGCGCGATTGAGTGCTG
CAATCCAAGTACTAACAGCAACCTCCGTCTCCTCGACAACACGTAATTCGATTGATTTTCGCCTACAGAGTCACCAAAAAGATCAGCGATAAACTCGTCG
ACAGGAAATTAAAGGTTTACGTACGGAAGCACTTGATGTGTAAGTCTAGCTGAAAACTTGAGCACTTGCAAGCGACGATGAGAGCTAGCACTAGATATAC
TGAAATCCATAGCATGGTCACCACGACCACGCTGCACAAGAGCATTATCCAGGAGGACAGCACCACGTGGAAGTCCATCAGCCTCACTAGCAAAATAATA
CAGTCGATTCCCTTTAAGCTCGAAGTAGCGTGGCTGCCATGAACTGCCCAGTCCGTGCTGTTTACGTTTTTTCTTCTTGAGCCAACCAGTTTTCTCCGGC
ACAAGGTGAGCCCCTGGGTCGGTGCCGCTATCATCATCGGTTATTAGAAATTCTCCTTGTAGTGATGCATGTTCTGATGACCCCGACGGTTGAGATGATA
AAGACAGCATAGACCAAGACAAAGGTAGTGCTGATATGTGTTCGTTGCTGTCTTCTTCCTCGTCATCATTGTCGTTTTGACACTGATCTGTTGATTCATC
ACCTCTCCTTCCAGTTACAGCCTCATCATCATCATTTTCGTGGGCCTTCCTGTTTACCATTTGTGCTTGTTGGACGCGCAATACCTCGATGTCCTCCACC
GCAAGTGTACTAAAGGGGCTAGTTGGAAGCGAGTCCACCTTGGTCGGCGCCGATTCTTCATCTACGAGTTGAATTGATGATAGTGGTGGAGAGAGTGGGT
GTGGCTCTATGTTTTCCCTGTTTTCAATGTCTTCATCACGACCGACTTGATCTGTAGGTGGTGATGCCTCTGGTTGCTGAATAAGTTCAGGCGGTGAAGC
CTCTGATGAACTAATCAACGGTGTACTCGTTTGCTTGGAGACTTCAGCTACAGCCTGGTTAACGCGATGTGCAAGTGTGATGTGTTCCGCGTGAAGCTCT
CCTGAACGCGTGAGCGGCAACGACACGGTCACGGCCCATAGCTGTCGACCAATCCACTGGAGTGCCACGTCTGGGTTAATGGGATTGGAACTTCCAACTC
CACTGCTAGATGAGACCGTGTCTGATGCCCATTCTGAGACTACCCTTGCGATTTTCGAGACGATAGCAGCACCTGCCTCCATGGTCCAGCACGTTATACA
AGCCTTAAAAAAATCATCTTCCCGGTACCAGCGTTCCACTCGAGC