Description :
From Genome Similarity Track
Location :
Scaffold_1387:7376- 8540
Transcript NameFunction/comments
Phyta_totarag12854ABC transporter ABCA1 lipid exporter family

Sequence
1164 bases(100 bases per row)
GACCGTGTCATCGCCGCTTGGGGTGGTCGTGTCACTCCAACCTGcaggcaccaccacgtcgtccacgaggtGCTTGAGTgcgccgagcagcagcacaaag
aGACAGGGCAGAGCGACCTCGAACACCGAAGCGCGGAGATGGCGGCGCTTCAACGTGTAGTTCttccacagcagcgtcttcatgtGCGCCCACGTCGTGC
GGTTGGCTGCCAAGGCCGAGCCTGAGACGGCTCATTCTTCATTgtggctggagctgttggtCGGACCGGTTGCTCACCAATGGTTGGTCGGCTGGCTGGA
CTGGGCTGGTGAGGTGGTGCAATTGAAAATGAGCTTTGGTGAGACCGAGGCTGGAAAAGGCAGGAGATGCACGAAGAGTTAGCCATCTCGTGCTGCTATG
TAGTGCCGCAAGTCAACGCATTTATTTAACTGGTCGATTGTGGAAATCACCGTGATCATGAGAGTGGGACGATTACGACAGGTATAAAAGGACAATCAGC
CGTGGTGCCTCAGAGTCCAGGAAAGTAATGAACGGCTTGGTATTATGTATGCAAATCGGGGCTATCCTTACGGGATCCCCCTTGCCCATTGACTAGCCGT
GGTGGTTTTCACTTCGTTGTGGTGGCCTTGTCCGCTGCTGGAAACTCACGGACCTCAGTACGAAGCACTAGGATAACTAACTGTAGGCAGAATCGAGCTC
GTGCCGTAGAAGATTCCGTGTGACGTTGGACTGTGACACCTTGATCCCCCTCAAGAACGTGGGTAGTACAATGCATCTAAACTCTCCTCCGTTGCTAGAA
GAACCCGACGACAGCACTGTGTTGGCATTGTCAACTTGGGAGCCGGCATCAGTAAAAATAATTTGGCCAAAAGGTGTGCTACAGCACACTTTTGCTTTAG
TGTAGTTTAGGTTTCTATGTAGGGTTTACACAAGGCTCAAAAACAGGTTGCAGTTACAGCTTCGTCCCTATTAATAAGAGTTTTTTGCTCATTGGCATCG
TGTATGCCTTTACGAGAGCTATCAAAGTCTTGGCCTCGCTCAGGTCGTTCTGAACCTCGTGGTCTTACCTGCTTAGATGAACGAGTCGTTCATCTAAGCA
GGTAAGACCACGAGGAGTCGACGACATAGATGGCATGAAGAACTAAATTTGTTTGTTCGGTTTT