Description :
From Genome Similarity Track
Location :
Scaffold_3:737585- 740032
Transcript NameFunction/comments
g18928.t1hypothetical protein

Sequence
2447 bases(100 bases per row)
TCCTTGTCGTACGCTGAGAAAATGACAATCGGAAGCGACGTGAAGAACAGGTTGTAGCCCTGTTGAACCAGCGCCGAGTAAATCATCGTGCCCGAGTATC
CTGTAGGCCACAGCGTGTACCAAAACATGGACACATTGTACGCAATGTTCTTGTAAAACGTGTAGACGACAAGCGCAGCAACTCGGTTGTAGTTCCATCG
ACCGTGAACCAAAATCAAGTTACTCAGGAACCGGAATTGACCCAGCGCGTAATCCGAGCTGTTCACAGCTTGCAAACCCTCCTGTCCACTAATGCCAACA
CCAATGTGAGCGCTCTGGATCATTGGAACGTCGTTGGCGCCATCACCGATGGAAAGAGTGTGAGACTCCGGAACGTTCAACTTTACTAGCTCCACCAGCT
GTGCCTTCTGCTGAGGCGACACACGGCATGCAACCACGACCTTGCATAGCAGTGCTACACGCAGGAGATGCAAGTTGTGCAGCGGGTCTTCCAGAATCAT
ATTCAGTGATGCACCATCGATAACCAGCGCGTGCTCAATTTCACCCGACGGTGGCGACAAGACGGAGTGGGCGGCAACAGTTGACGTGCGAGAAGCGTCA
TCAGTGGCATCGTGAATGGAGTGGAAAATCTTGTCGAGCCTTCGTAGGATCGAGCCCTTCGTGCGATACTTTGCCGCATTGATCACGTGTCGTTCCATGT
CATTGTTCAGCAAGCGACAAGCGTAGCCGATGTTGATCGCTGTCTCCTCCATGTCTCCAGTCAATACCCAAATACAGATCCCAGCCTTAGCAAGACTCTC
CATCGTTTCAGGCACGCCATCCTGCAGTCGATCTTCAATTGCAGTCGCACCAAGCAGCTCCAGGTTTGACTCCATCTCGTCCTGAAGTCTGTCAAGAGCA
TTGGGCTCTCCACGAGACTTGGCCTCCACTTCGCTGAGGTCTGCAGAAACATGACGATACCGTGCGTTAAAGTCCTCCCACGCGCGGGGATCGATTCGCT
TTGCACACACGACCAGCGTACGCAACCCATCTTGAGCAAACGTTTCTAGGTGCTTCTCGGTAGACTCGCGGATTCGTTGGTTGTTAGCCGACATCGGGGC
GAGTCGAGGAAACAGCATGCTGTCAGCTCCCTTTGTGAGAAGCAGAACGTCATCTTCCTCGCTTTCAGACATCTGACGCAGCTCATCGTCACGCTTTCGT
CGCTGAACTATAACTGACATACGCTTGCGGTTGGAGTCGAACTCGAAAACCTCTAGGATATCATACTGATCCACGACGCCATCGGGTTTCTTGATAGAAA
CACTTCCCGGTTCGCGCTCGATAAACTCGTAACCAAAGAACTTAGCACCACAAACAAGTGCGAGCTCATCTGGGGATGAAGCTGAGTAGTGAATAGGCGG
ACTGGTATCCTCTTCCGTTGGGTCCAGGCGCTCGATCAGGACACCGTGGCACAACGCCAGCAGAGTGAGAAACTCCTCAATCTTTTCATTTTGAGGGTCG
TCCTTGTTTTCTATGTCCCGCCACATTGTCTTGTCCTTAAAATTGACGTTGGGGACCGGGACCTCGACGCGTGCATCTGCGTCGTTCTCATTTGCCGATT
CTTCATCGATAGGTTGGCCCTTAAAATCACTACGCATGCGCGCAGCAATGCCAATGGCCGTAGTACCCTTGCCGTAGCTTCGGCCGCCAATACTGCACTT
ACGGAACTCCATTTTGTTGCAAGTAAGCGTGCCCGTCTTGTCCGAGAAAATGTGAGAGATCTGACCTAGCTGCTCGTTCAGCTGCATGTTGCGAACCTTC
ACCGGCGTGCCACTTTCTTCGTCGTACATGTCAAGATCGCGCTCCATGAAATACCCTTGCAAGGCCTTCACGAGAGTGATAGACACGTAGAGCGTGATAG
GCACCATTGAGGCGAGCGTCGTGAAGAAGTATACAAACGTCTCGATAAAGCTGTCATCCCAGCCGTCCAAATGCAAATACTCCGGCACGTTGAGACCATC
CATCCACAACCTGTCTCCGATGGCACCGACGAGCGACATCAGAATCAAAATCACAACAACGACGATCACTTGTTTGTTGGTCATCTCGTCAATAGACGAG
ACCTTCACGGGGAACTCATCGCCAGAGCTCATCATAATCTTGGTGTCCACACCCGTGTTCACCACCAAGCCATACACGTAACTGGTGTTTCGCAGCTTAC
TGCCGCGGAGCAGCATGTTCTTCAGCGAAAGAGGGACTCCCTCAGCGCTCCCTCCATTCGGGTTCTCCTCCAAGTACATCGTACCCGAGTACTGGTTGAT
ATCTCCGTTCGGGAGTTCACTCTCGACGTAACCTTGAACAATGAACCCGGCTTCATCCTCGTTCATGAAAACATTGCGGGTGGGCTGAGGTGCTTCCCGC
AGCTTCAGGTTGGTTTCGCCGTCGAGGTTCTTCGTCTCGACGTAGCA