Description :
From Genome Similarity Track
Location :
Scaffold_11:73753- 92503
Transcript NameFunction/comments
Phymu_g847hypothetical protein
Phymu_g848conserved hypothetical protein
Phymu_g849myosin-like protein
Phymu_g850conserved hypothetical protein
Phymu_g851phospholipid-transporting ATPase, putative

Sequence
18750 bases(100 bases per row)
TAgcaagctcttcgacgcAGTTAGCTCGTGTTGCTGACCGCTCTCCTGTACTTCTACCTCTTGCGTCTACTAGCAACGATGCGCCTCGTCATACCGTCGT
TAAGCTTCGAccaacgctgctgcattaCCTGGTTAACAGTCGCTTACAGGTGAGTTGAGACCCCAGCTCGGATTCCATGACTTCATACTGTTCTGACCAA
TTCTTTGTCAGTGTGTAATTAGATCCAAGGTGCCAATTACCGACGCAGCAGAACACAGTAACAACCGCGCTGAAACTGGTTTGCAACTCCTGGTCTCCAC
TGCAGATGGGAACGTGTGGGTCGTCACGTTGCCTGGCCACTTGCAGCCTGGAGCAGGAGTCGTGACCCGTGAGTTGCTGTTGGAACGCCAGCCCGGTAAC
AGTAATGATGGCTCGGTGCAGTGGTTCTGCCAGCTTCCTGGCGTGCAGTCGGTGCATTATACAGCAGCAGGGTCGGGGCTGACGACGCTCACGCTGATGA
GAAGCTTGATAACTCCAACCACTTTGATCGTGAGTATCCGCGGCAGTCCAAGCTCGAAATTGCAGCGGCACcagtcgctggagcttgatGGGATCGAAGG
CGAACAGTCTACGTGTGCATTTTGTCTCAGTAGTCAGATGGAGAATCATACTGGGCTGCTCAAGAGCTTGTTTCCGGATGTGGAGAAATATGCCGGTGTA
GCAGCTATTTTACAAGGAGATCTGGATGGCTGTGTGCGGTTTTCGTTGGTGCATTATCCGGCACCGAAGGGGGATATCGCGAAGGCTTCAGTGGTCCGCA
GTGGGACGCTCCTTCGGCTGGGAGAACCAGTTCAAATGATCGTTCCGTTCACGACTGTTGATCCCTCGGAACCAGATAATGAGGCAGCAGTACGGCAATT
ATTTGATGCGCTGCTTATCGTTGGTACTCGAGGCAGGGTCGTGGTTGTTGACTTGAAGAACGGTTGCTCAACGGAGCCTCTCCCTGTGTCACTAAAGATG
GAGCTTGGACGTGCAGTACAGTCCTTGGCGTTCGTAAACAGCTTGGCAGCATTCATTTTCTGCTCGAGTGGGATGGCGTTCGTGTGTCGGGTCACAGATC
TTCTTGCAAAAGCCCAATTCGCTGGTGCAGATGCTAATGTTTCCTTCGGCAATGACTCAAGTATTTCTGCAGAGAAGCTACCTCTTCAACCGGTACGTAG
CATCGACTTTTAAACACCAGGCCCAATAGTGTGCTAATTTCTCTAAAATGTCAGGGGATCATTCGTTTGGCAACCCATGACGGATCCCGCTGGATGTCGA
TTTTATTTGCCTCTGGGCGAATCACAACTATTGACGAATCTGTGCTTCACACGATGGTGGCTAGTGTTATGCCAGTATCTGGGCCGGAACGAAGCCCAGC
AGAGGATCTGTCCATTGAAAACCCAATGCAAGAGACTCGGGTTCGCAACCTTTTGCAGCGTATTGCACAGGTTTCCACTAAGTCAAGTGCCCTACGGACC
CAATCGAAGGAAATGGATTATCATCTCAAGAATTTACACTCTGCTTTGGAAATACTTCGGCAAGTAGAAGCTTCAGGTGTGTGTAGCAGATCAGTTGCTG
CTAGTGTGTGACCGTCTCATCAGTTCCTTGACTTCCTCAGGTGTGGGGTCCGTGGTCAAGTGCGAATTGAGAGCTTCAATGGCAATAGCTGGGCCCTTCT
CGAATCGACAGACGGTCAAATTGCTGTGTTCCTTACGTTTTGTGAACCCAGAAGCTATCATCTCACTCGATGACTGGTGCGTTGGTAGTTGCAATTCGTT
CATTTGGTCCTCTTTCGAACGTTCCTTATGAATCCTAACGGTTCTCTatggtgtacatgtaggttGCTGTGTCTGTACGTACGCACTCGCCAACAAACAG
TTACGACGTATTCGTTTCCGCTGGAGGATGTAGCAACACGAAAAGAACAGATCGTCATCCTTGACCCAGACACACTCACTCAGCAAGACCAAGGAGTGTT
ATGGGTATCGTGCTCGATGGTATTTTATCCTTCGACGAAGggagaccaagaagacaaaCACGGTGAAGCAAAACATGTTgcgttggagctgaagcCGACG
CCTCTTGAAGATCCACTGTCATTGACGATCCCGTTGCTTCAAGACCGAAGGTTTCTACTTGCACAACTGAGCCAGCTGATAGAAGAAGAGATACCAGTGA
GTCAAGTTGCCGTTCACGCTGCATTTCGTCAAAACCACGATCCGGTCATGTCAATCAGCAGAGCGAACTCTGATGGGAAGGAAGCATCTTCGCTTTGGGC
TGGTGGGCAGTGGTGGGCAGCACTAGCTGACCATGCACACAAGAACCCATCTTTTGCAGCTTTGTGGGCCAAAATTATGCcggcagatgcagcacctCTG
CCATTATCTCCCCCATCGCGATTCATACTATCCATacccttcttcttcgccgcagaagacgaatacgacgatgacgaagaagaagacaacgaAAAAGTTC
GcgtcgagaagatgctgttGTTTCTGCGCCAAATCCTGGAAATTCCCGCTGACAAGATCCCGCGACTTCGTCGTTGTTGTCGTACGCAGAATGGGAAGTT
ATGGACTGTACTACGGGCCTTTTCGGGGAGCCTCATTCTGCTGCGCTTCGCTCCATCAGAAGATCAGCAGCGATCCGTTGATCTCACTATCCAGTGCTCC
GACGTGGCAGATCTGTCAGCGGTACGTAACTTGGGGGATGAAATATTCCTGATCGTTTTAACACTAACGAGAGCCCCGTACAGATGCGAGCGCTTGTATT
GGACGCGATTAACAACTGGAGCGGTCTGGATCCTCCAGGAATTAGCGATGGAGAACGTTCTGAAGATCTAGCGCTGGATATGGACGAAGTATTAGAGCCT
ATTGTCGCTCTCGAAAAACTTCTGGAGGTTCGTAGAATAATTTTTGGCTTGTGCTATACTGGAGCTGTCAGTAAATTGTGTGCATCGCTTTGATTCATAg
gagctgaagttgacgaCTAAAAGAATTGAGAACCCCGACTCGGACGCTTGTACCGATGAAGTGCTGCATGCACTGTCCCGGTTGGCCCACCTAGAGACTC
AAACACTTACACTTTACTGGAAGACAAGAGTGCAACTCAACAGGACCATCATGTAGAAGGGGGCGAAAACGAAAATGTCACTATCCAGTGCTTCGAAGTA
GGTAGTATCTACACCTTCGTACGGACCGTTTGAAACTACTTGCAGGCATTGCCTGGCAGGCAAATTATCTTGTTGAGTGGCTCAGAGTTCTTCAGTGGGG
AGATGCTGATCACGCAACGACGCCTTCTCAGACGGTGATGACACCGAGTACAGGCGCTACGAGTGGAAGGAAACACAATTTGTTAATCACAGCTCTGTAT
CTCTCGCTACTGCAGCGTACCTCAAAGTCTCGTGGTGCCCGAGTTGGCCAAAGCATATAAATGAGGGCCAAATAGATAAAGCAATGCAACGACGTCGTTA
TAGCAGCTACCGTCTTCTCTCGCACCCatggcgacaagaaggatgCGATGAGCACGATGACAGGCAGCGCTACAAAAAACAACGAGAACAAGCAACACAT
CTGGGAACCAAAGAGTGAGCACTTAAAAAAATACATTTGGCAACTAGCGTCAGCTCGAGCACTTACTCGTAGGAAGAAGTGCCGTTTCGTCGAGGCTTTC
TCGTACGAACGCGTCTCCAGTATTGTGTTGATGAACCACCCGAGCACGCACATCTGCAGTAGGCAGATACCCAGACCTGGCCACGAGTCGTAGATGTACA
GTGTAGACGCCGGATCAAGCCACACTAGATACCACATCGCCATCGATAAGTAAAGCACGAGAATGGCCAGTATGACGCACGAAAGCTGGATCTGGCCGTC
CAGGGCAGCGCTGTTGATCGTCCATCCTTTCGCGATCACCATGGCAAGTAGTAGTGTGCCCACACGGACGAAAACTTCGGTGATATTGGCTGCGTACTTG
AAAAACGGCACTCCCACACCGTTGGACTGGTGCGTGGTGAAGTGGATGCAGAGCAAGGCATTGCACAGGAAGAAAAACACCACAACCAGCGTAAGGATCC
TCATGACTGGGTGGAACGACTCGCTCCTTGTCATGCCCCGTACTGCCACAAGTTGTGccaccgctgcagctcccgcCAGTGCCGTCGTGACGGCATATAT
CGTCGGCAtcccttgctgctggacaggGAGTTCGCTCCCATCCGCCTGGGTCATGTGGATATTGAACCATGACGAGAAGTAGTATTTGCGGAAATTGGTT
TCCGTGATCTCCGCAAATGAAGGTTTGTACTGGTCTCCCCCTGGGACGCAACgcgccagcgccacgtaCCAGAACCTCGGTCGTAGGTGTTCGTGGATGT
CTACGTTGAAGGTGAACGGGGTCACGTGGTGGTTGTTGATTGCGGTCACGTTGAAGACAGCTTTGGTGTGCTGGGCCGAGACTTTGCAGTTGCAGTCGCA
GGAACTGTCCGTCATGACGTAGTTCCAGAAGAGCGCCTCGTCGTCATAGACAGCCACCTGCAGTCCGTCTACATCCGTCTCGATTTCACCTGTGATGCGC
TGGCGGATACAGTCAAATGGTCAGTTTGAGCATTGTCATGGTGGAAATTCGTTCACGAACCCCCGCGATTTCGTCCAGCGTGGGCGTCCACgtgaagcag
aacttgcCGATGTACTGGAACTGCCGCCCCACAGTGTAGCCTGTGTAGATGCTTGCTTGCGCCACGGACAGCAGAGCCACAAAGCTCAACAGTATTAGCA
GGAATCGCATCGTGGTCTGGGAATCTGGGAACGTCGCGATCTTCTAAGGCAAccaacttcaagaaggcAAATGATTGGCTGATGAATTTATGGCTACATT
TTTATGGATGTTTTGGTGCAtttttctttcttttctCGACGAGATTGGTTTTACAAGTGCGGTTTTGTCTTGTGCTCGTACGTCTCGGTGTCAGAAGAGC
ATTCGTTCGCGATGCAATGCATTACACTTGCTAGCGTCACTTCACCAAGAAGTCAAGAATCTGAGGCGATTTCTGGCTGGGGGCACAGATCGTCAGTGCC
AGCGGATATTCTCAAGGCAGTTGGATTTCGGTACAGCAACTAGCGACTGGACTTGGGTTCGCTCGGGGTGGCTTGGGAGTTATCGCTGGTGTTTTTGTGG
TGGTGAGTGACGGTAGTATCCAGTTGCAAGTCGAGTTCTTGTTTACAGCCCAGAGTTTTCCACTACACGTATTAATACAGGTATCAGTGGCGTGCCTCAC
CGTGAAGGCCGACCGCCACAATTGAGTCGCCGCGAGTTATACCATGCCAGAACATGTAGTAACGGATGCCGACATGTGTTTAAATTTAAATGTAAAAATA
CTTGATCAAGCGGTTGTACTACAACTTGTAGAGGCCTCACTTCCCATGCAGCGGCTTCCGCGAACAACATCGTGCACCCACTTGACACGTGCACTTCAAA
CTAAACAGCTTCCTGCTAGTGGGGCCGGATTCAGGCACAGATGTGCGTATTTAGTGACGCAAAATGTGCCATGTTGGCAAGCGAACACCCCGCAAACAAA
AGGCGAAATTGCACCTTGTCGCCTTATCGTCGGTCTCAGGCGTCTTTCCCACCAGCTGGCGAGGAAACACTGTTTGCTCTCGACATGTTGGTTTTCGTAT
GGAAGGTACAGTAGAGACGCCTGGGTTAGGGAGCCCATAGTCTTTTCAAGTCCTATTTGGCGTGCAAATTGTCACTTGACCATCACTTCGATTGGCAGCC
GTTGGAGTCAGTTAGCTTTTTGTCAACGGTCCAGTATCAGCGTGTCTGGTCGTGTGCAGCGGCGTTGGAGAAAGCAGTGCGGAAAATCTCCTGTGTGTTC
CGTCGCGTGCCGAGAGGGAGTTCGAGCTTTGCCCGGAAGTCGCTCTATCGCAAACTCGCGCGCTACTACGAGAGGCAACAGGAGTGTCAGGTGTCGAGGC
TTGCGCCCCCCCCTCCCTCTTCGTCTTATCCAGTCTATTCGGACTTGTAGCTAGACACAGGAACATCTAGCAGCTCGTACGGACGCGTCCGGGAGTGTTG
GTCTCTCTGcatccttctccagcatgaCGGTGCGTCGCACGGAGGAGCTACAGGAgtggatctgcagcgtcacggcCTCATCCAACGATCATGGCGAGCA
CCTGTCGGTCATGCTACGCGATGGCCAGTTGCTCTGTCTCCTGGCGAACGGCGTGGACCCGACGGCCAATCTTAAGGTGAACAAGCTCAACACAGTTTTC
CACTCCAAGGCCAATATTCGCCTGTTCCTCGAGTGGTGCAAGAAGCAGGGGCTGAACGAGGGCGAGATTTTCCAGCccgacgacctgctggacgCAGGGG
CCGACTTTACGACAGTTTTGGAGACGCTCTCCATCCTCTTCGACAGGTTTGGCACGATTGGCTACACTGGCGAATATGAGGAGGACCCCGTGTCAGATGC
AGAGTCGATGACGTCCACCGGCAGTTCACAGGGACCGTCCCCcgtcaagaaggcgcacagcaacaacaagctcaCAAGTTTCATGAAGGGTGGATTTTTa
tcgaggaagaaaaaatcgagcaagaaggtggtggacAAATCCCCACAGGGGACGCCGCCATCTACTCCCCCGCCAGTGTCTCCGCAGGTGGACGGTGGAA
TGTTGTCACCGTCGGGCTCTCCGCCCTCGACACCGCTGGAACCGCCCCCACAGAAGGACACGAGGAGCAACAGTGGGGGTGCCAATGCAAATCGGCTGAA
CGCCTTCCTGAACCAGGTGCCGGCTTCCCACGGATCTCCGTTGACGCATGTTGAGCGTCCATCTGGTCCGCCCAAGAAGACCAACTCAGTGAGGAAACCA
CCGGCACCTAAGCCGGCGCCCAAGCCGCAGCCTACTGTTAGGAGACCTCCGTCGCCCAAGCAGCCTCCTAAGTCGATGCCGACCGGCGGGGATGCTCGCA
ATAAGTTCGCGGCCTTCATGAAATCCAACCCGCCGGCTGTCGAGACGACACATGGTTCAGGCCCTTACCAAGGGTCTGGTGGCTCGAACCTCTCTGCTTT
CAAGTCGTCGGTCTCTCCCACTGCGGATTCTAAGCCGCCTTCCCCGCCCAAGTCTGCACCTGTCCGGGGTCGCGGTACGTCAAGTGACCAGTTTGCACAG
CGCAAGGCAGTGTTCGCTCAGGGCAACAGCAGCCCCAAGCCAGACATGCCTGCCCCTGCTCCGTCAAAGCCGAAGGTTAACACAGGAGGGGGTACCAAAC
TGAACGACTTCATGAAGCACCAGCCGTCCGCTTCCCCTGCGTCATCGACGAAGCCACGCTCCCAGAGCAAGTTGGCTGCTTTCCTCGCTACGACGAACTC
GATTCCATCGATTGCGACGACGCCTTCCGCTGCTCCACCGAAACCGACCTTCGGTTCGTTTAACCCGTCGAAAAACTCCCCGGCCGGCGGTCGATCAGCT
CCGACGCCAGCGTTCAATGCAGCACCCGCTGCACCGATGCCTTTCAAACCGCGCCACATGATTGAGCGTTCGACGGGCCGCGGTAACTACATCCGCAAGC
GTCAGACGTACTGGGTGCCTCCTAAGCGCCGtcgcagcaacttcagcttggaaaagaagcgcaaggccttcatgaacgagcagctggaaattaaggagga
gcagctccgacaacaagctgcaggtgctAGCAACAAACAGAACCTGATTGTGCCGGGAGTGCAGTGCTACATTCCTGACAAGGAGGAagtgtggctgctg
tccgaGATTGTGGACTACAATGACCGTCGAAAAGAGGTTACGATTACGGCTTTTTTGGACTCAGGTAACTCGGAGCAGCGTGTTGTTGATCTCAAGAATC
CGGAAATTAttcgtgctgttgctggacCAACGGCTACCGAGGTGGAATCGCTGCCTGTTGCAATCCTTCACGACAACCCTGAGGGCGTGGAGGACATGCG
TTTGCTTCGATACTTGAACGAACCTTCCATTCTGTTCAACTTAAAGCAGCGTTTCACTGCATCAAAAccgtacacgtacacgaaTGACATCGTGATTGCA
GTGAATCCGTACAAATGGATCGAGAACCTGTACGGTGACCACCTACACGAGAAGTACCTGAAGAAGCCGCGTGATTCGCTTTCTCCTCACGTTTACTCGA
CATCAACGGCTGCCTACAAGCACATGAAGACTAACGAGATGAACCAAAGTATTCTCGTGAGTGGTGAGTCTGGCGCTGGTAAGACGGAAACTACCAAAAT
TGTGATGAACCACTTGGCCAGTGTGGCTGGTGGCCGCAAGGACAAGACGATCGCTAAGGTCATCGATGTGAACCCGCTTCTCGAGTCTTTCGGTAATGCC
AAGACGACGCGTAACGACAACAGTTCGCGTTTCGGTAAGTTCACGCAGCTGCAGTTTGACGGCCGAGGAAAACTGATTGGTGCCAAGTGCGAGACCTATC
TGCTAGAGAAGTCGCGTGTGGTGTCGATTGCTGAAGGCGAACGCAACTACCACATTTTCTACCAGCTTCTGGCTGGCCTACCCAACCATGAGCGGAAGGA
GTTTGGTCTTGACCCTGATTGCCAATATCAGTACGCTGGTTCCCTTGCAGAGATGCAAATCCCTGGCCTAGATGATGCCAAGTGGTTTGCTAGCACGCAG
AAGTCGCTGTCCATCATTGGTCTGGATAGCAGCGCGCAAAAGACGCTCTTCAAGATTCTGGCTGGTGTTCTCTTGCTTGGCGAGGTCATGTTTGACAAGA
GTGGCGAAAACGGATCCCGCATTTCGAGCGGCTCGGCTCTGTCACAGGTCGCGAAGATGTTCGGACTGCCCACGACGAGAATCGAGGAAGCTCTATGCAA
CCGTACGGTGATCACTCGTAACGACAGTGTGACGGTGCCACTTGCTCCGGTTGAAGCGGCCGAGAACCGTGATGCGTTAGCAAAGACCATTTACTCCAAG
ATGTTTGACTGGATGGTGGTGAGAATCAACGAGGCTATCAGTACGGACGAGAGCCGTATCAAGGGCCAAATCGGTGTGCTGGATATCTTCGGCTTTGAGG
ACTTTGTTCACAACGGCTTTGAGCAGTTCTGCATCAACTACGCGAACgagaagttgcagcagaagttcacTACCGACGTCTTCAAGACTGTCGAGGACGA
GTACATCCGTGAAGGTCTGCAGTGGGATCACATTCAGTACCAGGACAACCAGGGTATCGTGGAGGTGATTGAAGGTAAGATGGGTATCATCGCCTTGATG
AACGACCACCTGCGTCAGCCGCGTGATACCGAGGAGGCTCTAGTGAACAAGATCCGCACAAACCACCAGACGAAAAAGAACGGTGTGGTAAACGAAAGCA
TCGACTTCCCTAAAGTCAAGCGCACGCAGTTCATCGTCAACCACTACGCTGGCTCCGTCACTTACGAGACGGTGGGTTTCATGGAGAAACATCGCGACAC
GCTGCAGAAGGATCTGCTGGACTTGATTCAGCTCAGCAGCCTGTCACTGCTTCCGGAGCTTTTCGTAGACAGCGAGGCTACGACGGAGGGTGGCAGCGGC
CGTGGCAAGAAGGCTCCGAAGAGTCTCGGCTCTCAGTTCAAGACATCGCTGGCACAGTTGATGGACAACATCAGAACTACCAATACGCATTACGTGCGCT
GCATCAAACCGAACTCGAACAAGAGCCCGACGGAGTTCAACAAGCGTATGATCGTGGAGCAGTTGCGATCGGCCGGTGTGATCGAAGCCATTCGTATCAC
GCGTTCTGGCTACCCGAGTCGTCTGACCCCGAAGGAGCTAGCTACGCGTTATGCCATCATGTTCCCGCCGTCTATGCACAGCAAGGACGTCCGCCGTACG
TGCAGCGTTTTCATGACGTCGATCGGCCGCAAGTCGCCTCTGGAGTACCAGATGGGTAAGACGCTGATCTACTTCAAGAACGGTgtcatggaggagctgg
aagccaTGAAGTCCGACTTTATGTACTACGAGGCTCGCACTATCCAGCGTATCGTGCTGGGTTTCTTGGAGCGCCGTCGCCTGCGCAACAAGATCGGTGC
TGCCATTGTCTTGCAGTCGTACGCCCGTATGTCGCTGGACTACAAGGAGTATCACTTCCAGCGTCGTGCGATTATCAAGATTCAGcgtggctggaggagg
tACAAGGCTATTCCGGTTGAGCCCGAGTACAATTCAGAGGAGGAGTACAATGGCGGCGGCCAGTgggtggacgagatggacgaccTTGATGACTCGGATG
CTGACGAGGGCTTCGGTGATGACCCCGCTTCGGTTCGTGCAGGACGTGGCAGATCGATCGCGGACCGGATGGAGTCATTCAAGGTGGCTCACTCGGGTCG
CCGTGGCAGCGTGAAGCGTCTGAACGAGCTTTCGCAACGcgccaagagcttcatgaagacgcgcagtggcagcggcagcacttcgagctcgagcggcATC
TCTCTGGAGGATGAGAACTCGATGCTCAAGATTGAGAACCGCAACCTGAAGTACGATCTGGAACTGATGCGCGAGCAGTGCATCGAACTGCAGGCCATCA
TCCTGGAGATCAACAAGAGCCGCAAAAGGTGAagtgtgtgtgtgctgcGGTGTTCCGGTCCTCGTTGCGTTCCCAGCCCTGAGCGCAGCCAGAGGACAAC
AGTTTTTTAAGTAAACGCCGCAAGGCGTATATCTGTAGCGAAAGACAAGAACAAATTTCTCTTGCAAACATGTGAAAACGTTGAGTAGTTTACATTTTAG
TGTGTTGTTAGTTTCAGTCTTGACCTTGATCGCTGTAATTGTCGAGAATTCGCGGGAGAGAACATTGCGAGCTGTATCACATCCGTCCATCAGCAGATGG
ATGCCTTTCCTTCGCTGTGAGTCACAGGGGACATGAAAAACGTTTTGTGTGGCTTCCAGCATCATCCTCAAGGCTCGAGTTTttcgaagcagaagaggtG
TCAGGGGGAGCGAGAGCTCGCGGCGCACTGCCGATAAGTCGGCGTAGATGGCACTACTGATGCCCGACATCAATCTCCGCCGTGCTAAGCGCCACCTCGA
GGTTCGTCTTGCGATGTACTTACTACTCACGTTTTCCATCCATCCGAGTTTTGATGTTGTTGTTCTTGCCGTTGGCCGGTTATTGTCGCCCGTAGCGCTA
CTGGCGCCAATTGCTTGGCGGGGACCGACCAGGAGAACGCAGGCGCTTGATATTTCGATCCAAATCCGTTGCGAAGACTAATAAGactggccaagctgca
gtgcATGAAAATGCCACCCCCACCACTGGGATCAGCTCCGTCGAGGTGGCACCACCAATTCAAAATCTAGAGCCTGACCCGGAAATGGAGGTCGACGACC
AAGAGGTGGCTCGTGGTTCCGACAAGCGAGGTGTTGAACTTGATTGTGGGTCGTCATCGGCGGTGCAACGCGCGAATTGTAACCAGGAAACGGAGACGAG
AATTTATGGCTGCGGCAACGGGAAGGACGAGGAATATCGTCAAGAAGTGAATCAAGTGGCCactggtgaagctgctgctgcagtcgatgaGCCAGAGTGC
AACGAATCTGCTACCACTGACGAATTTTCAAAGCTCGAGTCGCAGCAAGCTCCGACATCGACGAGCACAACTggaacttcatcgtcgagatcCGCAACCT
CCGTGTCATCGTCTCGAACTAAGTCCTTTAGCGTCAGCAAGCCGCCGCTATTTCGTGACAATAAGCACCTGAACAACATGCCACTACCAAAGGGCAATTC
GCGAGCTCAAGGTCAGTTGCAGCATTTCATTTCCTCATTATGACAAATGTTGTGTTGACTCATGGAGGTTGCAATGCATTAGGTCCGACGCTAGGTGCTA
TGTTGCAACGTATCCACCTGAACGACGGAGACGTGAGCGAGCTAGATTTCTCAACGCTCGCGCAACGCAACAAGCGGCTGGGAGCTGAAGGGTGTGCTCT
CGTGGCTCGTTCTTTGACGACTAACCACACAGTCCGGAAGCTCTTTATTCGGGACCACGCTatcggagacgacggtgcGATCGCTCTCTCGAAGATGCTG
TGCAACAACACAACTCTGGAGTACCTGGATCTGTACGGCAACAATATCGGTGATCGAGGAGCTGAGGCACTGGCACAAGCCCTGTATGGACACGACTCGC
TGAGGCATTTGTCTGTGAGGAGCAACTTGATATCGGATCGTGGGGCTGAGGCTCTTGCTCAGGCCATTCGCTGCAACTGCACGATTAAGTCTCTCGAGCT
TGTTCACAATCGGATATCAAAGGTCGGAGCACAggcactgctggaagctttAGACGTTAACAGTCacctggagacgctgaacttGGAGGCAAATCCTGTG
CCGGAGTTTGTTGCGAGTCagcttgctgcagcgctggcacGCAATCGAGCCGAGTCGTTGATTCTTGAGTCGCAAGCCGCAGAAAAAGAGGCAGTGAAAA
TAGTGCGGAGAGCTAGTGGCTTGGAAaccgaagaggaagatgacaGCAGTAGTGATCaggatgatgatgatgaagactGGGAAGAGGACGACTGGGAAGA
TGATGACGGCGATAGCGTGTCGAGTGGTTTTTTAAGCTGCTCCGGCGTGACAGACATCCCGTTGAGTAGCAGTGGGTTATGGATTTAAAGAACCACTGGG
AAAACATGATAATAAAACAAGTTGTAGAAGGCGGATGTGAAGTTACGTACTTTGAAGCAATCCCTAAATCGTTAAACCTGAGCCTCTCGATCAGCAAAAG
AAGTTTGCCGTATCCTCCGGCATGTTGTCACCCAGTAATTCGTGGCACTCGAGATCTGTCACCTTTGCATCCGCTCTGCCAACCAATATTTGATGGTCTG
GTGCTTTGGACGGAGCCGTGGTTGGATACTGGTATCCCCACATTTCTCGGTAACTTTCCTTGAACAGTTTGTTTAATTCCCAGTCGATTTTGTCTTCGGC
AGGTAGAGCCTCATACAGCCCAAGATGTTTCAACGACTCGTCATACCACTCATTCTTCGCCGTCAATGCTCCGAATGGCGAGAAAAACTTGTGGATTCGA
GGTGATGTTTGTGCTTGTGGCGGGCATCTCACAAAATTCTTTGGCGTCAGAAGTAAGCTTGGTTGGCATTTTACTGCTGTCCCTTGCGTTTCTTCGCTAG
TAAGCTGCTCCCAGTTTGTCGCATCCCGAATTTTAGCACTGGGCATGGGAGTAGCCGCGGGCGGAAATGTGGGCGATGCCATCAAAGCTGATGCAGCGTG
AAGATTCTGCCAGTACGCTAGCGGTGGAGAAATCAACTGGTATTCCGAAGATCCTGACTGGGGACTGTTAAGACCACGCAAGCTTATCACTATGTCGTCA
AACAGCGGCACGCTGTTTGTAGAGTCGTTCCGGTTCGTCGCGGGAGCAGGGATAGCAAACAGCAACCGAGGGTTCGTGAAAATGTCGTAGTTGAAGCAGA
CGTGCTTTCGAAGACATTTGTCAACACATTTGGGGGAATGCACGAGCGACGTATCTATCATGTTGCAGCTCCCCAGCACAGACACTACGTCATATACACG
GCGCTGCACGTCACTGTACGCCGCCACTGTCGTAGAACTCGGCGCCACTGCGGAAGCTTTCTTTGCTTCAATAAGACGGTCGCTAATAGTAGACAATTCC
ACTCCAACGTGATCCTGTTGAAACATCAGACCCAAGAAGCAGACCGTCATCGTCACCAAGCACGGCCAGTTCTCAATTGTTGCCTGGTCCTCAAAGGTTT
TCACGAGGGCTTTATCTTCATCCACAATGCTGCTTCTCATGGAGCGATGAGACTGCCGAAAACTCATTACCGCTTGCGTCGCGTTGGCTTTCATGCATTC
CAGATGCTGCACCACTGCAGCCTTGCCGTAGTACCGGAAATACGCTCCCTTGGCGTTGCGTGCCTCATTGTATCGGGCACGTTTGATCACTCCAATGCCT
GTAGCCGCAAGCGTTATGATAATTATCCCCCACCAAATTTGTGCAAATAATATaccttccagcacgtgcaaCACGTCGTAGATCCGCCGTTTCCTCGGCA
CTATGTAGCGAGCATCAGGACAGGTGCCATCCACTCGCGAAAAATGCACGCCCTACCCTTCATCTTGTAGATTTCACTCGTTGGGACAAGGATCGGGAAC
ACGGGGCCAGACACAGAGCGCTGCAGCCCCTCGTGCTCCTTGAAAAGCTGCAACACTGTGAGCGttctgaaaaaaaaaaaaaactcagCATCAGTGGTcc
ggcggtggtggtgctcacCTCATATTGAAACGTACATCTCTCCCAGGCTCTTCGCTGTCGCGAATCGTTCTTGGATGCCATTGGCAATGGATGCTGGTAA
GCTGTCCACAGGACTTGCACTCCAGTCTGACACTGACTTGACACGCTGATGGCGTTTGCGCCGCTTAATTGGCCGCTGGGAAGCTTGCTCCACTTTGACG
GCTGCCTTTGGGGCGACGGCTTtggtggacgagaagcgcaacTTGCGTCGGTGTGCGCGCTGGGCCTTCATACTTGCGTTCGATCCGGCAACTTCAAAAG
TGAGAGGTTAGAAAGATATTCCACtgaagtgaccatcactctgttTCCGTTTTGTTGAAGTGTGATGAAAGGCAACCTTCTTACCAAGGCACCCTGTCGC
TTTAGACACTCGAGTCATTTCTTGACAGTTTATGTGACCTAATTTTGCCACAGCGCTGAATGTCATCTCCGTGTGGCATTTAGATGATCTAAATGCCACA
CAGAGATCTTTAGATGATCTAAATGCCACACGGAGATCACATTCGGCGATGTGGCAAAAATAGTTTTTTTCATCCGATTTTGTGGAAGCTCAGCGGTCGA
GGAAGGCGAAACCCCCTCCTCTCATCTCAACATGTTTTTGCTGGACTATTCCAAGCAGTTAGTGTGCCGCATTCCAGTCTTCTTGCTGTACTTTGCCCGG
TGAAGCTACCACTAGGCGTTCCCTCTCACCTTCCTGCTTGTGTCTGGCTACAGCAGTTCGTGACAAAGTGACCCATGGGTGAAGGAACGGCGGGGAATGG
CGGGAACTTCCGCGTGGTTCATTTAAACGATGCGCACCGCAATACCGAAACAGGCTactgcaacaacttcatTGTGACATCGAAGTATACGGTCGCGAGT
TTCCTGCCCAAGTTCctcttcgagagcttccgcAAGCTCTCTAATCTCTACTTCCTCATCATTTGCATTTTGCAGTGCATCCCTCAAATCAGCAATACCA
ACGGAAACCCTTCGACGTTGCCACCTCTGCTGTTCATTATCACGGTGGACGGTGTGTTTGCAATTCTCGAAGACCACAAACGTCACCAAGCTGACAATAT
TGCCAACGCTAGCCCGACACTGGTTTTAGACCGCGAGACGAAGGCATTCAAACAAGTTACGTGGGCTGATGTTGTCGTGGGAGATATCGTGAAAGTTGTA
AACCGTGGACTGGTACCTACAGATATGCTTGTCATCGCGGTAAGCGAAATACCGAATCAGCCACCGTGTGGCATTTGCTACGTGGAAACCAAGTCGTTGG
ATGGAGAGACCAACATGAAAGTTCGTTCGGCAATGGAATGTACGCTAGCAGATATGGGCTCCATCGACAACTTGCTCAGGATGAAAGGTGTCATTCGGTG
CGAGCACCCGAACAATGCGATCAACAGCTTCCAGGGTGTGTTGGAGCTCGAGGGGAAGGAAAACGCCTCTATCCCATACGAAAGCATCATCCTGCGTGGT
TGTATTATCCGCAATACTGAATGGGTGCAcggcatcgtcttcaacactgGCAAAGATACGAAGATCATGATGAGTAACTCGGCACCTCCATCGAAAATGA
GCTCGATGGACCGGTCTATCAACCAGTACACAGTCGTGTTGCTGTTAATCTTGATCGTTTTTAGTGCTGTCGGTGCAACCGGTGCAGTGTCGTGGAAGTC
GAACCACAGCTCCGTGTGGTATCTTGAGTTGGATGCGTCCGACAACAGCGCATTCGTGGACTGGCTTATTATGCTGTTCTACTACCTGCTTCTCATGTAC
CAGTTTGTGCCTATTTCACTAGCTGTCTCCATGAGTATGGTTAAGTACCTCCAAGCTCAATTTATCCAATGGGATGCCAACATTTACCACCCAGACACGG
ACACCCCGACACTGGTGCGCTCAATGTCACTCAATGAAGAGCTCGGACAGATTTCATATATATTTTCCGACAAGACTGGAACGCTTACCTGCAACGTCAT
GGAGTTCCGGAAATGTTCAATCGGTGGTGTATCATACGGCAATGGAACAACGGAAATCGGGTTGGCAGCTTTACGACGTGCTGGTAAACCTCTTCCAGAC
ATGACTGCGCAATCTAAGGGCCCAAAGGTTCCTTACGTAAATTTCGATGGGCCGGAATTATTCAACGATATGAAAGGAAACTCGGGGTCCGTGCAGCAAG
GGCGAATCGATGCATTCTTCACGCATCTTGCAGTATGTCACACTGTTATTCCTGAACGCCATGAGAATTCTACAGAAGTTACTCTCTCAGCTTCATCACC
TGATGAGCAGGCTCTCGTGGCAGGAGCTGGGTATTTTGGTTACGAATTCGTGAATCGATCACCTGGCATCGCGCACGTTAAAGTTCGAGGTACCGTCCAA
AAGTATGAAATGTTGGACGTGCTGGAATTCAACAGTACACGAAAGCGAATGAGCACGATCATCCGTCATCCCAATGGCCGAATCTTCTTGTACTCAAAAG
GAGCGGATGTGATCATTTACGGACTCTTAGTACAGGACAAAGAACATGAATCCACTTCATCCCTGCTCCAGGAGATTACCCGCCGCCACATCGATCAGTA
TGCAGAAGACGGCCTCCGCACACTTACGATTGCGGTCCGTGAAATCGAACCTTCGCACTACGCTGAATGGGCAACACGCTTCCACGACGCCCAGAACAAC
TTGAATGAAATCGACAAACGCAAGAAGGACCTGCCAAACGCGATTGATGAATGCATGAATGAGATTGAGTGCAACTTGGAGCTACTTGGAGCTACTGCAA
TCGAAGATAAACTCCAGTCTGGTGTCCCCGACGCGATCGCGAACTTGGCATGTGCCGGAATTAAAATCTGGGTGCTCACAGGCGATAAGGAAGAAACCGC
TATTAACATCGGCTTCGCTTGCCAGCTCGTGACGAATGACATGAAACTGTTCATCATTAATGCGAAAAATGCACCGACCCCGGAGATACTAGAAAGCACC
TTGAGAGATGAGATTGGCGCTCGAGGTGCTGATGTCACCGTTTACCTGGCTTCACCACCGGCTACTCGAGGTGAACTACGAGATCTAGCTCTTGTTATTG
ACGGTGAAACGCTGATGTATGCTCTGCGGGGTTCGATTCGCCCACTCCTGGCAGAATTCTCTCAGTACTGTAAAGCTGTTATAGCGTGTCGTGTGTCTCC
TGCGCAAAAAGCTGAGATGGTTGCATTGATCAAAGAGTACGTTCCTGGTGTCCGTACCCTTGCTATCGGAGATGGCGCAAACGATGTATCCATGatccaa
gaagcgcacgtAGGAGTTGGCATATCAGGTCAGGAAGGTATGCAGGCTGTGAATTCGAGTGACTACGCTATTGCCCAGTTTCGCTTCTTACAGCGGTTGT
TGCTCGTTCATGGGCGGTGGAACTACCGACGCATGGCGCAGTTGGTGTTGTATATTTTCTACAAGAACATTCTCTTCACCGCGGCTCAGTACTGGTACAC
ACTTCTGTGTGGATTCTCGGGGCAGAAATTTTTCCTAGAGAGCGGCACGCAGTTGTACAACATCGCACTCACGGCAATTCCAATCGTTGCGGCGTCAATC
TTGGATCAAGACGTAAATGATGAAGTGGCCATGGCTTTCCCGAAGCTATATTTCACAGGGCCACGCGACGAAGACATCAACACCCGTATTTTCTCGCTCT
GGGTCATTGGTGCAATTGCCGAAAGTATTATTATCACATTCCTTACGATGTACAGCTTGCAGGCTGCTGGATTTGCAGGAGGGAGCCCCACAATGTGGCT
GGAGGGCTTCATCGTATTCACTTTGGTTGTGTCGATTGCCAATGCCAAGCTATTCATGTTCCAGAACAGCTTTTATTTCTTCAACTACTTCCTGTACTTC
GGTTCCCTTGTCATGTGGCTCGTGGTTGCGCTGGTGTGCAGTCACGTCGATTTCCTTGCTGATCTCACATGGGAACTCATGATAGAGCATGCGTTCGGCC
TTACGTCCTTTTGGTTAATCTGGTTGTTCGTCCCAGTGGCTGCACTGTCGTACGCGCATCTGCTCAATGGTGTAAGATCCACTTTTTTCCCTGAATATTG
GCAACTGGCCAAGGAGGTCATTAAATTCAATCTCGATCGCAAGCTCCTGCAGTGGAATGACAACAGCAACGCGTCTGTGGCGGTACCAGCTCGGCTTCCT
CATGCTATAAGGGTCGCTAAGAAAAGTGGCTCGGTCATCCCCACCGatggccgacagcagcagcaccggaCAACGGTGCAAAAGGCGTATCATGGGTTTG
CCTTCTCCAAAGACGGTTATGCAGGGGCCACAGAGACTCGATTGCTCATGAGTCGCAGCTCCATCACAAGTGTAACGTGAATAAATGAGTGCGAAGGTTA
GGCCCTAGTTGAATTTTCACGAATACACAAAACTTCCTGCAGCGAGTTCT