Description :
From Genome Similarity Track
Location :
Scaffold_4:7372- 8445
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_4-snap-gene-0.51Conserved gene of unknown function

Sequence
1073 bases(100 bases per row)
ACAACTTGGTAGCTAAGAACGCAGATAACAACACACTTCATAAAAGCCTCATGCGCTGCTTGCTAAGACGTCGTGTCGTTTGCGTAGTGTGTATTGTATG
TTGATGGTCAATGTCATATTTGGTAGCCGTGGACAAAGTCAACTGTATCAATTGCAATACATGATGGGAAAGAATACGCATACCTGAGGAAGCCGCAGGA
GCATTGTTTGAGCGCGACAAGGGCATCAAGTTTGCAATTTTGCACCAATACGAACTCCTACGTCAGCTAAATTTGTCTGTGCCACCATTTTTCGGCACGT
GATTCTGAACAGGAGCAAAATTGGAGACTGATCATCTGGAAAAGAGAAATGCTTGGGAGGGGAAGAGTGAAAGTTTTTGCCAATGTTCGGGATTTCAGGA
GGTAGCGTCGTGTGGTGAAAAGTGTCCGAAAGCGCTGCAGCATTACAACTCGTGAAGGAGCTGGCAGAACTATGCATCGGATACCACAATTGTGACGAAG
TTCTTGAGCTTCGATTCAAAGGTGTGTCATATTGCACTTCAACTTCCTAAAATGCTAATTTTATGTGGGTTCACTTCATTTGGGAATACTTAAGTTTGTT
AATTTGATATCGTCTATACGTATATCAATTTGGAGAATCAAAGCGATTCCCAGACTCAGACAGATAGGCTGACCCACATATCTGAGCCGACGACGGCTCT
CCCGCCCTACATTCAAATGTTTAAAAACCCAATCACATACTCGCGCCCCATTTTGCAAAACGGGCTCTCCCCCCCCTCTGCACCACTCCAAGCAAGCGCA
TCGCGAGACGACGTCGCATACACAATTTGTACTAATACGTGCTCGAGACGAGGATGAACGTGGACAGTAGCGGGAACATGGTGGTGTCCCCCATCAGCGC
CAGAGGGCAGGAGCGGCTCGCTCGGTTGCGCGCGACGATCGCGCATAAGTTTGGCGGCGCGAATCCGCCGTCAAGCAGCAAAACGACGCAGTTCCAGAAC
ACAAGCCACATGGCTGCAACTACGACTACTGCGCAAAACCAGCGCTCAAAGATTCGTCAGCGGATAGAGCAGG