Description :
From Genome Similarity Track
Location :
Scaffold_226:7371- 10557
Sequence
3186 bases(100 bases per row)
CCCGTACTGGTGATACGGCCTAAGGCGACCGACGTAGAGCGTAGGATGCGTGCGCATCTTACGTGACAGTTCAATCGTGTATGCGTTGCCTCTGCGGCGC
AGCACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCAAGGTAAGTTTACCGTAGATAGTAGGACTAGGT
CACCTTCATTGAATGAAAGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTCTTTTGTCGGTCCACTGCTTCAGCAACGGAATCTTGCACGAAACGGAC
AACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGGCTGTAGTGCGCTTGAAACGTACTGTGGCAAGATCAATGACCTAGGTAGTA
ATAGCATCCTCGCTATTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTGATGAGTGAG
AGACGAGTTGGCGTTCGCTCGAATGATTCCCTCCCCCCTCAAACTAGAGTTACACTTTAAGAAGGTGGGTAGGCGTGGGTGGCGCAAGCCATTCACGAAG
AACGGTGTATGCTTCGTCGATGCACGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTCGCTCCAATTCGTAAACAAATGGACATAACCCC
GAAGGATTTCCTCAAGAACGCGGTTTGCACGTTTTGTCTGACCATCTGTTTCAGGATGGTCAGAGGTCGACATCTGAAGGCGCGTTCCGAGTGTTTTGAA
CACGGATCGCCAGAATTCAGCAGTGAATCGTGGGTCTCGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCAATAAAAACACGA
GAACATGCTGATGCATTGATGGATTCAGGCACAGCGACCAGGTGTACCATTTTACTGAATCTATCAACGAACACAAGAATATCTGTACTCTTGTGTGGTT
CTGCGGGGAATCCAAAGACAAAGTCCATTGAGACTGATTCTCAGCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGTGAAGGACCTGCCTT
CACTCGTTGACATACTTCGCATGCGCGGACGTACTTTTGCACGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGACTAACTGTGATATATGTCTTCTCT
CGACCACGATGTCCACCAGTAGATGCATCGTGCTACTCATACATGATGCGCAGTCGCAGGTCACTATGGTCCGGTACGACGACACGAGGCGTGTCGCCGG
CAACGGCTGTATACTTCAGTAAGCCATTGTGGACTGTATATCTATCCGTGGAGGATCGATATACTGGAGAACCTTCTAAGGGATTGACGGGATGGTTGCG
AGAGATGATCCATCAAACGCACCATCGCCGGATCGTACGCCTTGCGTATGTCTTCGAATAAGGTTGACGACGGGACACTCAACGTCAACACCGCGACAGT
GGTCGGACCAGTGTTGGGTTACGCAGCCGGTTCGAAATCGGTCCGGCGTGACAGAGCATCAGCGACGACATTCAGTCGTCCTGACTTATATTTCACGGAG
AAGTTATACTCCGCGAAGAACAACAGCCACCCCGCCACTCGTTGCGAGAGGTGTGGACTGCTAACGACCGTGCGTAAGGAAGCATGGTCCGTGTAAACGA
TGAAGGGTCTATCGCCTAGCAGGTAGACCCTGAACTTCGCCAAAGCATACTTCATGGCAAGGGGTTCCTTGTCATGGACGGGGTACTTGTGCTCAGCCGG
TTTCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAATCACTTGCATCGCAGACC
ACATGAAAGGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTCGAATGAGCGCTGACAATGAGCACTCCATG
CCCACTTCTCATTTTTTTTCAACAAACGAGAGAGATGAACAGTCATCTCAGTGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAGGCCAAGGAACTT
TCGAAGCCCTTTTATGTCGGTAGGCACCGGCCAGTCAGTGATCGCCTTGATCTTTTCCGGATCGGGCCGGACGCCGTGCTTACCCACGATACATCCAAGA
AGTGGTATTTCTCTTGCAGCAAATATACACTTCTTGAGGTTGGCGTATAACTTATGCTCACGCATCAGTGTAAGAACTTTCCGAACGTGGAGTCGGTGGA
CTTCCAAATCCTTCTGTCCATCCATAGCCCGGCTATGGACGAACACGTCATCGAAAAAGCTGGGTGCAAATTCTCGCACAGATCTCAACAGATTCGTAAC
ACATCTGTTGAACGTAGCGGGGGCATTACTCAGCCCTTGTGGCATTACAAGACACCCCCAAAGCATACCGCTTGGGGTGCTCACTGCTGTATAAGGAATG
TCCTTTTCACTCATAAGGATCTGATAGAACCCATCCATCAGATCCATCGATGAAAAGATGGTACTTCTTGACATACCACCTATAATGACATCCTTTCTTG
GTATCGGCGTTTGAGCCGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTACTATCCGCCATCCTCCTGTGGCCTTTCGGACATAGAAGGTAGGAGA
TCTATGTGGGGAATTAGGTTCTCTCGTATGGTCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATAGCTAGTACTTGTTCACGAGGCAATGGCCATTGC
TTCATAACACAATACTTTGACCCTGGTTTCAGGTCTACCTCGTGACGAGTACCCTTATCCTTGGGTAGCTCGCACGGCACTGTTTATGGGAACACATCCC
TGAATTCCGTCAAATCATCATAGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTATATCGCTCAATCCGAGTCCTCTCATCAAGGACACTCTC
GTCCATTGATGAGCTACTGAAAATCCTTTCGTTCTCAGCGAATACCATTGCCGACCGAATATCGGTTTACTCGTAATCCGCGACGAGTACGCAAATCTGC
TTGACTTTTCCACTACGCATATCACGCAAGAACATTTTCTGTTCGAGCGTGGGCAATCGAGTGATCTCCGAAGTTGTTTTCGGAGG