Description :
From Genome Similarity Track
Location :
Scaffold_68:737- 3907
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_68-snap-gene-0.16Elicitin SOL7
Pytul_var.sporangiiferummaker-pug3_contig_68-snap-gene-0.17Conserved gene of unknown function

Sequence
3170 bases(100 bases per row)
GCCAATTGCCCCACTGAGATACTCGAATCTGTGTTTGAGTTGAAGTTGTGAACGAGAGGTGGACATCTCCTGGTATCGTTCTGGTGCAGGAAGCACGTCC
GATATCACCCATTTCAAACGAGTCCCACTTTGCACAATCACAGCAGCCCATCCCGTCTGAAATCTGGTGTGGGAGGTGTCACTGTGGCTGTTCACAATAC
CTCGATCGTGATAGCTCCAGCCTTGGTTTTGCTCCCTCAAGGTTGTGCTCAGCCCGGCGAAAGTCAGACTGCGGGCATGTGTCACGTACCTCCTCCACTC
CCATCGCAGCTCTGCTTGATTCAAACCTTTGACAAATGCACTGGTTTGAACGTTTCAAACAAGTTCATTGTGAACGTCACATTTGACCCAAGCTTTTGAT
CGAGAGATCGGAAAGAAAAAGCAGCGAGTTTAGAGAGATGGACACATCGTCATGCGGATGTGGCGTGTCGTCGTCCTCGTTTTGGTGGAGACCCTCGCGC
CACATGAATTGATCGATTGATGCCTTCAAGGATGCGCTGTGAGTGTGTGTCCGTCTCATCTCGCACAAAGAATGGACTTCCCTGCCATTTATTGCGTTGG
CGCACGACCTGCGATGTAGTGCGAACAGCCAATTCTCACGAAACAAAGCATAGTCGAGGTGAATGGCGATATGCAGCTCCATTAGCGTATCAGGACCTGA
TGGACTGCTAGAACTGTTGGTTGGTGCATTTAATTTGACACTCAGATGCGCCAACCTACAGTTCTTTGGGCTTGGAGAATTGCCACTACAAGATGTTACA
TGTGTTGACCTGAATGCTCGCTGTAGGAACCCTGGTCAATGTTGTGCCCTTGTGACACAAACGGGTCAAGTTGAAGTAACAGGTTTGCGGGAAGAGGTCC
CACCTACTCCGTTAACACTGCATCAAATATAGACTGGCGAGGCAAGGGAGAGTGCGGTCAGTAACTTCGCTGCGTTCCAGGATCCGTACAGCTCTTGCCT
TCTTCTTTCTTCTTCCTGCCTCGTTCTGGCGCTGGCCTTCGATCACAACTTCCACAGGATCAATTCTGCCTCGATAGCCTTCCTTTCATACAGTACACAG
TCGCATTATGCACTCCCCTCGTTGTGCCTTGAAGCTTGAAGCACGTCGAATTAAGGGCCTCGAGGAAAAACCCAACGGGGGAGGGATACGCACACAGGAA
ATGAAGGAAGCTGTCTGAAGTGCTCATATACCTTGGTAAGTGTATCGAAGTATTCACCAATACATAAAGGGCGTCATGCATATCGAGGTACTAGAATGCT
TTGGAACTGGTTAAGAAGCAGGCCTCGCAAAAATACCATCAAGATAAAGTCCTTTGCTGTTCTCACCACTGCTGCCACGTGCCTCGTCACCAACACGGTT
GCCTACAGCGCCGATGCTTGCCCAAGCTCGGAGCTTGGGAGCTCTTTGATTTCGCCTTGGAGCCGAGCGTTCCAGTCTGTCCAGACATTTTGTGACTCAT
CTTCTTGCCACCGACAGACTACCCATCTGAGGACCAGATCCTCTTGATGTGCGTCACGACAGCGTGCGTCAACATCATTGTTGTGCTCCAAAGCTACGGG
CTCAGCGACTGCGAGGCTGACTTCAGCAGCATCCAGCTCAACATGTTGAACGTTACCGAGAGCTTCGCGCTAGCTTGCGCTGCTCTTGGTCTCACTAGTT
AAACATCGCTCCGGCCAGAGCGCTACTCTCAGTAGGAATGCTTCTGCAACTTTCAGCTTGTTTATTTCGCGCAACCACGAACGCACACGGTACGTAGGAC
TTTCGATGACGGTGATCAAAAACTCGTCCGCAATAAAACTACACTGATCCGTTTGCTTCTTTTGCCGTTGATGCCGCAAAACTGAGAAGAGAATTACCCC
CATCGTAAAATAGGTCGCACAGATTTGTTGCTCGTCAAAACGGGGGTAGGATGCCAAACTGTGCTCTGTTTCGCACTCTGTTTGTTCCGCTGGAAGCCAC
TTGAGACTGCGTCGTCTACCAACAAAATGGCGGCTGCTGTGGTTCCGCATCCTCGCACTGTATCAGCAGCGGTCTAGGTTACGATGAAGATTCGTGGTGC
TTTGAACTCCAGCCAGCGTCGATATTACCTACGGTTGGCCTATCGCTGGCAGTGAAGGACCGATTTCTCAGCGTGTGTGCTCTCAAAATCTTCAACAAAA
TCATGCGTTGCCCACTATTTCTCTTCGTGTTCTTTGTCATCAGCGCGCTCTTGTACGCGGTAATGCTATTCCTTCGGGCTGACAGGACGGGGATGATCGT
CGCGCAATTATGTGCGTTTGGTGGAATCCCTGTATCACTCGTTGGTCTTGGCTTGCTACGATACCAGGTTGTCGTGCTGATCATCAAGACGTACGATTTC
TGGTTCTTTATTTGTTTGAGCATAATCAGATTTATCACGCTTGCTGGCGTCTTGGGTGCAGATCGCGCGACGTTAGCGCTCACTTCGTGGGTCGGAATGG
TCCCAAACATCCTCATTTATGCAAATCTGAGAGCGATGCGAAGCTGGGCCATCTTCAGCATGTTTTCCATGGGCTGCTACATCTTGACGTGTACGATGGT
GACTTTCCAACTCGTGGACGGGATGCGAGAATTTGCCGTCTTGAGATACAAGTCCCACGAACTACCTGCGACGTCCATGTTGTTGAGTGGATTGTTCACG
ATTATTGCGACGGTAACGCGCAATGTTCACTGAACGCGCCATACTTTCGCGAAAGAGCAGTCAACCCACATGTCCTGAAATGTGTCACGTACCACGTCAA
CCTCCAGCTTTGCATGCGCGTTGAGCGTATTCAAGTCATAGTCACGAAATCGAATACAATGCCACCACACATCCAGCGGATGCGGTGTATGAAGCTGCTG
CACTCGGTCAACGAGCGGCGAACTCCCGTACCGTGGCAAAGTATATCCAGGTTCGCCTTTACCAGATATGATTCGGAAGATGTCGCCATCTAGTGGACGT
TTCGTGCTCTTGGTGTCACTGTGCTGCTCTTGTTTTTCAGTTCATCGGCGCTCGAACGCAAAGGCAAATCCGACCACAACATTGTCGATCCGAAGCGCAG
CAGCATGAAGCACCCTGTCTTGTATTCGCAAATTGCTTCCCTTGGTCTCACGATTACATACTGCGGTACC