Description :
From Genome Similarity Track
Location :
Scaffold_173:73687- 77673
Transcript NameFunction/comments
Hyaar_Emoy2811867PREDICTED: DENN domain-containing protein 5A
Hyaar_Emoy2811868hypothetical protein

Sequence
3986 bases(100 bases per row)
CTTTGCGCTGTACGCAGTGAGTCAAGAGTTTTCTTCTTCGGTGTTGTCGCATCAGCTTCGCGCGTACTGGACGGCGACGACGAAGTGCTCGAGCTGCCAC
CAGCCCAATGATGTGCACGCAAACCATAACTCAACAGCAGGGCCGAGAGTCGCATGAAATCATCGATAGAGTCTTTCTCGTCTTCAGACGATAGTTTTGG
ATACAGTGAGAATTCAGCGTAAGCACGGCTTGTCAGAAAGCGATGATACAACTCCAGGTGAATGAGACTAAATCTCGTCAAAATCGCGTCTTGCTCCGCC
TGAAGCCGAGCACAGGATGTCACCAGTGTGCGCGACAAAGTCTGCATTTCAGCGTCTCCAGCATAGTATTTTTGGGAAATGTACTTGAGCAACCTCCTGC
AGCGGTACGCGGACTGCTCAATGCGCTCGCGGCGCTGGTTGCTACTAGATGATGCAGCACTTCGAGAACTGCCGCTAGCCTTGAGCATCGACATATATAT
GCGAAACGCCGGTTTAAACTCGTATTCGACATCCAACCACAACGCAATCTCGCGGTGGTAGTTGTGCGGGAACAAAAAAATCCAGAAAAAGTTACCAAAC
CGGTGGTTCATCAGTATGTCCTCAAGGCAAATGACTTCACGCTCCACTGTCTTCTGCATCTCAGCATAAAGCTCCGTTTTACGGAACTCAGGAAACTTAA
ACATTAGTAATCGTTTCACTTTCACGGCAACATCATCAAACGTGCGAAGTGCATCTTCACCCCCGGCCGCTAGATCGTGTTTGATGGAGCGCAACCTGTT
AGGTTCCACAAGCGGTGGCTCGTCACTGCCACCCTCTACGGTGTCAGCACTAGTAGGACCATTGATCGGAAACTGGGCATTCTTCGCCAGATACTTCATC
GCGATCTTGACACCGTACGTGCGTAACATTAGCACATCGTCCTTCGCAAGAGGCTGTCGCTGGTTGTTAGCACGCAACGTACACCAAAATTGACGATATT
CCTCAAATGAACAGAGGAAAAACAACTTACTTTGATCCGCAGGATCAGAAAGCCATGCTGCATAGTAGCGCATCATTCGTGGGTTGCTGATGACTTCCTC
AATGGAAATAAGGGTAGTTGGGTCAGGAATCGGCTGGTGTGGTGGAAACGCAAATTGCTGTTGCTCCCGTTGCAGAACTCCGTCCTTATAGGCACGCTGC
ATTACTTTGCCAAAATTGTGCTGATATCGATCATGCATCCATCGGTTCCACTTCTGAAACTTGGCGCCACCATGTGCTGCTGGTCCAAACGACGGTAGCG
GGGGCAGCAAGGAGTGACGGTTTGTGGACGACGAGAGCACAGCGTATCCACTACCATTACTTATTTGCGCGAGTATCTGCTTCTGCTTGTTCGCCCAGAT
CTCTGCCGACGTCGGCGCAGTCGGTGTCATGTCACCACCACAGCTGCTGTTGCTAACTGTTCCATTTTTGCTGCCGGCTACTGTTGCATACAGAAAACCC
CGTGCCTTTAGTTTGACGTGCTGTGCCCAGCGAGACTTGGCATTTTCGAGTTTGACACCCTCCTCTTCCTCCTTTATACTCGTAACTTCGTAAGCATTGA
CATCGTCATCTGACCCGCTCAGCACTTCAGAAAGCTCTCGAGCACTCAGCTCACGCTCCGGTTCAAACAGATCCGTCTCATACAGCATCAACTCCGATAT
AGTACTTCGTCGAAACGTACTACGACTCGAGAACGAGAAGGCTAAACTGTCCCGCGATCGCTTTGACATGGCAAACGAGTCCCGATCAATGACTGTAAAC
GTCCCATTACCCACTGCATGCGATCGTCGTTGATGGGGCAATCGAAAATCATCCTTGTCCACATACAACGACGAGTTCAGTGCACTCGCCAAGCTCTCTC
GAATCACTTCCTCTGCCGATATCGTGCTATCTGGAGGTAACGGCGGACTTGCGTCCAACGACGCTAGTTGTTCAAAATCAATGAAAACAGACCAACAACA
GAACAATACATAACGTAAGCATCTCGACAACCTCTTCGCAACCCCCTCTTCTTCTACTCTACAACGTACAAGCTCTTCGAAACCTTTCGGCACCACTGCT
CTTTCTTCCACCGGTAGAATCTCCCAGCATATTCCGTGTAAGTCGTCCACCATCAGCCACGGTATCTCGATCCTCCAAACTCGTCGCTCTACCATCACCA
TCAGCAGCAGCAGCAAAACCGACACCACAAACACCATCTTCATCCAGCAACTCATTGGCAGATTTCACATCGTCCATCAAGAAGCTCGCGTGGCTCCGCA
GCGATGCGGAAGAAGACGCAGGAGCGCTTGCGCCCGCATGAAACCGCGGACCTGCGCTCTTGTGCAATTGGTGCGAAGCGCTTTCTTGACCATTGTGACC
GAATGGGTAAAATCCTGAGCGACTGGGACGTCTTGAGCTGCCTACAATGGCTTCTGCTGACGTACAGCGTCGGAGCTCTAAGACGTCGCGAGACAAGAGC
GACGTATGCGGCGTTTCTTCGTAGCTTGCGCTGCGATCAATGCGTAGATTGGCCGTAGCAGCGGTAGAAGAAGCTGCAGAAGGTAATGTGGTCAATACCG
CGTTGCTACTGCGACTGCGACGGCGAGGACGCGTGCGGAGACAGACGCGCACGACGTCGTCGCTCATGTCGAGTGTGTGTGCGACTACAAAAGTGACGAT
ATCGTACGTAGTCGGAGTGTACGGGTATATCCCTTGTGTGGTTGACGTAAATAATGTGGTCGACGTACTGGGCGTGAGTTTTGTAAGCGTGTGTGGTGCA
CACAACTATCTGACCTTGGTATTCTCAGACAGCTATCGAGTTGTGATCTATCTTGTTCGATCGGGATGACTGAGCGTCGAGAGAACGCAGCGCAGGACGC
GGTGATCAAGGTGTTGGTGCTAGGTGATGCAGCTACGGGGAAAACGAGTTTTATCAAGCGGTGCAGTTTGTTTTTCTTTTCTTGAGCTGATGAAGGGGAG
ACTACTGATTGACTGGTTGATGGTGAATCAGATATGTGCACGACGTTTTTACCGAGCACCACCGCACGACGATTGGCGTCGACTTTGCTCTGAAGGCAGT
GACAGTGTCTGGAACGACTGTGCGACTGCAGCTGTGGGACATTGCTGGCCAGGAGCACTTTCGTGCGCTGAATCGCGTCTACTATAAGGACGCGCTGGGA
GCGCTGCTCGTGTACGATATGTCGCGCCCAGAGACGTTTGACAGCATTCTAAAGGTAACAAGAGGGAGGTGAAAAATGAGAAGAACAAAATGTGCTGTTG
TTGATGTTTTGATGCTCATTGTTTGGTGATATATCGTGCTGGTGGAGATGTAGTGGAAGAAAGAGATTGATTCGAAGGTGGAGTTGCCTAATGGCAAACC
GCTGCCGGTTATTCTATGCGGCAACAAGGTGGGAATTTGCGAAGATTGCCTCTTGGATCATTGCAAGCTGGTGCTGCTGCAATACGAGACACTGGTGGTC
GTTATGGTAATTGTTGATGTGATGGTGATTGCGTTTTGCAGTGCGACTTAAAAGAAGATGTGGACCGAGAATTTCTGGACGAGTTTTGTGTGACGAACAA
TTTTGCGGGATGGTTTGACACGTCAGCCAAGGAGAACATCCACATTGACGACGCTGCCAAGGCGCTGGTTGTGGGCGTGTTGAAGCACCCAGACATTTTC
GAGCGGAAATCGGAGGCGAAGAAGCGTCACGATACGTTCCGCCCTATGAGCACTGCTAATGGAGGCAACAGCGACCAAACCGGTTGGTGCTGCAGCAGCT
TCTAATCTACCATTCTGTTAGCTGCAGGACCAACAATCATGCAGCAAATTCATTTCGTCGTCCAATGTTGCATGTCGGACGACGTTAATCTGACTTTGGT
GTTGTGCAACTTGCGTATTTTATATTGTGCTCAGTGCTAATCATTTTTTCTGACACTACCTGTAGCTACTGGTTTCGAATCTAGTG