Description :
From Genome Similarity Track
Location :
scaffold_3:736694- 737896
Sequence
1202 bases(100 bases per row)
ATATATCCCCAGACAAGCTGCCGGGCAAATTGCCATCTGGAAAAGGCATTCGTTATGGAATTAACATACTTCCTGGTGCGATGTATTATATCAAATTGTA
GTGTCTGTAGTCAGAACAACAAAATATTGCAAGCGATGAGATTTATGCGCAGCAAAAGAAGGTCGGTCATGCGCGTGATTGCAAGATTTCGAGTTGTAGC
CCGCCTTTTGTGCAAAGAAGACATTTGGTGAATGACGCAATGTTCATACTTTCAATAAGCTAAGTGGTGCGATTGTACCAGCGCACAGACTCCGGGCCCA
AGCAAGGATGTAATCCTTGATAGAATGGTTGGCAGTACTGCATCGATCCATAAGATGGTTTATACCGATTCGCAAAAATGGTTCCACAAACAGCAATCAA
GACATGATTTCGGAATGGTTAGTAATGCCCCATGTCTTCAAAAATCGGGAAGGGGATTAATGTCGATGTTTGTATTGATCGTCTTTGTTAACGTCTCCTC
CTTTACGCGATTAAAAAATTCAAGCTTACCTGAAAAAGTGCAATTTCTTTGCATCCCAACTCCTCGATCTTGGTTGATTTGCGGGAGAGAACGGCGTTTG
TGTACATACGTCGAATGTCAGATCTATCAATAAATTACCGTAACCAAATTATGTGTAACAGCCGAGCCGATGGCTGGCTTGACCAACCATTGGCACAAAT
ACACGCGCAATTTTGCAGCGTTCGTATGATCCCTAACGTTGGGTGGAATGATCAGATATTCCAAGCGGTATTTGTCAAAGTAAAGTAGAGCTTCCGAGAA
GCTTTGTCGTTGTACAAATCACGACAAGCCACTCCATGTCATCTGCGAGTCATGTGACtatgccatcggctgtgcgttgatgcaacacgatgatgaggGT
CAGGAACGAATTGTTTTgtatcagtcgcgacgactTCGGCCCGCGGAACGTAATGACTCAGTTCATAACAGCGACCTTTAGCGACGAAATATACTTTAGT
TGAGTTCCGTGTATACTTACTTTGAAAAGAGCGCTTTACCATCCAAACGGATCATGCCTCGCTGCGTACAGCAGTAAAGACTCCTAATTTATTGCAGAGA
ATGGATTAATGGCTTCATTCTTCGCAAAGTGCAACTTTGTTATACACTACAAGTCAGGCAAAACGAACATTTTTGCTCACGCTTTGTCAAGACTCAGACT
AT