Description :
From Genome Similarity Track
Location :
Scaffold_127:73649- 74684
Sequence
1035 bases(100 bases per row)
GCGCATGCATTCGTTGGGTACGGTGCACGGGAGCAGATACCGCAATGACCGTGCAGCCGCGCGCCTTCATTGCACGGTGGCAGTGGTGAGTGCCAGGTGA
AGTAAAATAGATAAATATTCGCAAAGTCCCTACAAAAAGCGCTGGTCGTGAAGCCTACTTTAATATTAAAAAATATTATCGTCTCTACTTTAGAAAGAGT
GTGGAAAATAACATCGCCGAGCTCTTACAAATGCGGCCTGTGAAGCTTATATAAATAATATTAGTACTATTAATATCGCCTTTACTTTTTTGAAAAGTGT
GTGGAAAATAACATCCCAGAGCTCTTACAAAATTCTGGTCTGTGAAGTCTACATTAATAATACTACCTCCGTTCGGAAAAAGATATCCATTTGTTTTTTT
TTGCGCAGCGCTCCGCCTCGTTCATTTGAGCGTTTATTAATTTGTGAGAGGCAGCTAGCTTTATGACCGAGAGCTGACAGTGAGAAATTAAGCAAGGCAC
AGGCGTTCATGCTCCGCCGTGCAGCTACAGATACAAAAACGGATCTAAGACGGCAACTACATCGCCACATTCTGAAGGGGCGCTCAGTGGGCCTTCTGGA
ACTTCAGCGGTAGGCGGTGGGGGGCTGCTCGCTGCAAGAAGCAGCATGTACGCGTTAGCATTGGCGAGTGAGGTAGCGTCACAAGGCAGTGACGTAGGGA
GAGTGCCAGCATGTACTTGCTTGTCCTTGTGCCGAAGGCGCGCCAACTCGTGCGTGGGTGTAAGTAGTGGGCGGGTCTGTCTGAGCGCACGCCGTATGTA
GCCTTCCTTGATCAGCTGCTGAACCGGGTAGCAGCTCATGTTGGACGCGCGCTGAAGCAGACGCTGGCTTTCGCGCTCATTGACAGGAACTGCAGCGATT
CTCTCGCACAGCTCAGCTCGAACCACCTTCTTCCTACCACATGCGCTCTTCCTTGACTTGACCACGGCTGCTACTCGATCTCCCATCGAATTGATTCCAC
GCCTCCAAATTCGCCCGACAACTTGGCGGCCCATA