Description :
From Genome Similarity Track
Location :
Scaffold_12:73631- 76603
Transcript NameFunction/comments
Albla_Nc14016450glucokinase putative
Albla_Nc14016460
Albla_Nc14016470

Sequence
2972 bases(100 bases per row)
AGCTGTCCGAGATAGAGAGCGAATATCAATGGTGATAGATCATATCTAACAGGGTATCCATTCTCTGCGCTTTGATAAGACCACACGAACGCATTAATCA
CTTCAAATCGCGTAAAATGTACGCTGGCATTGACATCGGAGGCTCTGCTATCAAACTGGGTCTTGTTGATTTGGATGGGAAGATTCTGACTCGTAACCAC
ACTAATGTCGATTTCCAACGCACGACACCGCAGGATGCGGTCACAATATCGCACAGAATGCTATTAGAACAGCTAGAAACGGCAAGACAAACGTGCTATT
TGATGTCTGTACCTCTGTAGACTTTTCATTTTAAATTGTGTAGTTAGGGAAAAATTCCAATGATATACTCGAAGTCGGCATAGGTTTTCCGGGCCAGATC
AACCAGTCTGGTGTGCTACAAGCAGCTGCCAATTTTCCCACTTGGGCGAACGTTCCCTTAAAGCAGCTTTTTCAACAACGTCTTGGTCTAAAAGTATGAT
TGCTCAACGAAGATACGTACATCGCTCCAGCTTCAATTTGTTGCAATGCGCATAGGTCGAGCTTCTCAACGACGCTGACGCAGCTGTTTTAGCAGAGATT
TGGGTGGGAGCTGCGAAAAAAGTTGTCGAAAACTTTATTATGATCAGTGAGTACGCTGTGGTTGTAGAGTGTGCATATGAGCTCACTATAGACTCGATGA
AGCTCTAGGTACTGGTATCGGAGTTGGCGTCGTGATAGATGGCCGGCTCATTCGTGGTGCACGTGGCCTTCTGGAGGGAGGACATATGGTTTGTGTATCG
GCTTGAGCCAAACCTCAAGAAGTCAAGGAGCGTTATTTTTATCTTAGATAATCGAAAAGAACGGTCGTCCATGTCCATGCAGTCAACGTGGATGTCTGGA
GGCTTACGCATCCGCAACAGCTCTTATCTCGTATGCGAAGATGAAGTTAGAAGCAGGTTCGAAAGCCTTGCTTGAACAATCTGATGAATGACGGAATATG
TTTAAGGAACACCGTCGAGGCTGTCTCAAGCTCACAATGAATCCATCACGGCCGAGATGATCTTTAAACTCGCTGAGGAAGGCGATACAATGTGCCTGGG
TATTGTTGAGGAGGTACCGCTCTTTCCATGGCTGCTCACATTCTGATGTTTGTGAATAGGCAGCGGATTGCTTGGGTTTTGCTTGTGTCAATTTTAGTCG
AATACTATATCCTGAGGTGCATGGAGCTGCCAGATTCAAATGTGCTTCAACTCATTAATCCTAAGAACTTGTATAGCTCATTTTATTCTCCGGAGGGCTG
GCTGAAGCCGGGGAATTCTTCCTCGAAATGATCAGGAGAGCTTACAGCAAGTATACCTGGACAAAATTCCCGAATGAGGTAGGACTATACATCAAATCTA
CATCTGTGGCCCGCCGCTTACGTTGTTGCTCAGGTGAGTGTCAGAAAATCAACCGCTGGATATGATGCAGGTATAATTGGAGCAGCGGCAGCAGTACATT
ACAAAAAAATCAACTGAGTTTGACCTTGAGGCAAGGATTTTTTCCTTGTTACCAGAAGGGTTGAGGATTGCTTTCAGCGATTCAAATAATGATGCGTCGA
TGGAGTGGATAGAATGTCTGAATGAATGGATTTTGGCTGCTTATGTCTGCTATCATTTCGTATAAGACCGATGAAGTGCACTACTAGTGAAATTGTAACA
GTCAAAGGTACACATGGTATCATCTCAACACGATAGTTTTTCGACTTACGCGTGGTGCAAGTACCATGCCTCGAGTTCTGTCTCAAAACCTGTATTTTGG
AATACTATGCTCCTTCGACATGAGAAACACCAATGGGACTGCATCAGGGTGCACCACCGTCACTATCTATCCAACTATCCATTCTCATCAGCATGCCGCT
GCTCATGCAAGCTCGTTCGCACCCAACAAATCTGGTCCTATTTCTGCACACGTACGATCTCGTTATTTGCCCCAACGCTTGTTACATCTACGCTGTGGCT
TTCTCGAGAAAAACGGTAGGTATTTGTTTGATCGATATCACCTGGTAGGTGCTTCTGCTGCATGTGCATTCTTACATACACATGCCAATCGCTTTGTATT
TGTTCACGTAAACTGGAGACAGCATTCGCTTTGGTAATACACGACGATCAATTTCGTCCGTAATGCATACGTGCATAGTCGCTGCAATTTAAACTAGCAA
TCACCATGATTACTGCGAGATCAAGCGTGATCATGTGACATATTGTGCGAGTGGTTATGGAAGGACTTGTATCAATATAGAGTCTCATTCGTACCGTTTC
GGTTTCCTCCCGCAACTACATCACTAGATGTGCTCTCGCAAGTTCCCAATACAACTGTTAATCAAGGTCAGCATGGATTGGCACTTTTTGATGGACTAGA
AAGTAGCAAGACTACATGCATTCAATGCGTATGTGACTTGAACCAATAGGTGAAGTTGTCAATAATGATTATGCACTGATCTCTCACTCATCGTCTGGCT
GAAAGGAGGCTTCGGAAGGTGTGTCACTCTTATCTCCATCATCGTCCTGATCAGCTCCAGCGTCGCTATCAGATGTTTCTATAGGGTACATCTTCTGTGT
TCGGCGCCGTCGGCCTCCAATTAAAATGAGGTTTGTGTCGATTCCTTCCAATTCTTTCTCCGCATCTTTCTTCTTCTTTGCATTTGCGATGTCGAATTTT
GAGGGATACTTACCTCCTTGGAAGCTGATCCCACTTTCCTTTAACCGATCTCGCAGTAGATCCTCAGCTTCTTCATCATCAGTGGCAGTCCTCAACTTTC
GATATATTGACGGACTACAAACAGCACATTCAATCGTGACGACTTCCCTATGGTTGCAAAACTAGTTTACTTGAGGATGCCAACTACCCGAGCTAATTCC
TTCAAAGCTTGCAGCCCATCCGAGTAGTGGGGCTGGTTTATTCGACTCTTCTTGATTGGATTTGTCTTCTTT