Description :
From Genome Similarity Track
Location :
Scaffold_148:73629- 76092
Transcript NameFunction/comments
g14660.t1RAW31158.1 hypothetical protein PC110_g12492 [Phytophthora cactorum

Sequence
2463 bases(100 bases per row)
CTTGGTGTCTAGCGGGGGAATTGCAGAATGACTTCGAGCGGCGGAACGTCACCCATCGCGGATGGCTACACTTGACGGCCAGGTGATTGGGATGGGCGAT
CTTCTGATTTGCACCCACAGCATTTCGTGTACATGTTGCTGTTGCCTTTGCTCCCGTGCTGTGTAGCCATTTGCTTAGTGATGGTATGTAGCGACACGTC
GGAACTGGCAGAGAATCCGCTCCTGTCGGTTGTCGAGACAAAAATTGCGAGTGGATCTTGGCCTAAAGCAGTCTCATATTGACTCGAGTTGAGTAAGTGG
CAACGCTCATGTTGCCAGTGCTCGCTAATTCGGTCCGCGTCGCGATTTGCAGTGTTGAGCGAAGGGGGCAAGCTATACATACTCGTGCCTTTCTCGGCAT
TTGAGTGAATTCTTGTCCCCGTTGCTGCTTTGGCAGTTCTCTTTTTGCCTTCTGCTGCGGCAGTGAGACTCGAGCCATGCTGTCTTTGTCCTGCGTCACC
GGCGCGGCGCCCTCTACGCCGACGGCCGACAAGATACCGACGGGGCCATCTGCGACCAAGCGACTCGCGTACGAGACGTTCCGCGACAAGCGCGCGACGT
CGGCAGAGCTCCACAAGCCGTTGACGACGCAACTGGAGCGAGCGCTGCGCAACTACGACAACGTGGGGGCTCAAGTGAAGCCTCTGGCACAGACAGACCC
GTTGACTCTGGCTGGCGAGGGCCCGTCAGCTCTGATGGAGATCATCCGCACCCCGCACCCGCACACCCAGAAAGTCCGGAAGAGCAGGAGCCTTGCGCTG
CCGGCGATACCGAACGTCGACCTGGACGAGATCGAGATCCCAGCGATGCACGAAGGGCTGTGCCGCGTCTTCTGCCAGCCGAACTTGTGGTCGCCGGCGT
TTGCTTCGCCTGGAGACTTTACCATCAAGATGGCGTCCGTGGCTCTTGACAACGGCGAGGTCTGCTTCCGGATTGCAGTCATGTGCTGCTGCGCCAGGTC
CATTTGTGATGGCTCGCGCATCAAGCCGGCTTCCAAGCGGCAGTACTACGTGTCGTACATCGAGCGAACGCAGCAGGAGATCGTCCAGCTCACGGAAGCG
CTGGCGCTGCAGTATCTGGGCCACCGTTTGGCGGACAAGATGCCCACGCACGGAACGCGGCTCATTACGTCTCGGAAACAGCGAGCCCTCGATGAGTACG
GCGAAGAGGTGATCCAGTTCTTGAGCTTCGTGATGCAGATCACCGCGGTTGGCTTCAACGGGCTTGTAGCGCTGAGAGAGCCCGTGTCGAGCAACGTGCG
GGTACGAGACTTTTTGGGCCTCGCGCTGGGCTTTGGAGAGCAGACGATCGTCGCGACGAGCTCGTGTGACGCTCGCATCGAAGGCCAAGATGGAGGCAAT
CGTCCGGTTCTGCCAAGTGCTTGGCTAGACATCGACGTCAATATGTCGTCGGATGCCAGCTTCTACGGGAAATGCTACGCTACGAGGCGATCGCCACGCG
ATGAGGCACTCTCTCGGATGTTTGGTCGCTCGTTCGACAACGGCAGTACTTGCGGCGAGTTTGGTCCGCTGATGCGGTCGATCAGCAGCATCAATCGGCC
GGGAGCTGGCAAGTGTGTCCGCTTCATCGATCCCTGCTACTGGGTAGACGAAACACCTAACGACGGCACGTTCACAGTGGAGGTTTCCAGCGTGTCCGTC
ATGGATGGCGTCGCCAGGTATGCTATTAGTGTGCTCTTCTACGCGAACGGGGAGCTGGAAGTGGCTACCGTCGACCGTCGCTACTCGGAGTTCGATGAGC
TAGCAGTGACGCTCGAGGAGAAAGTTCCGTCGCTGCAGATCCGCAAACTGCTGCCGCCGAAAACTTTCTTCCGCTACTTCTCCGCCAGCTTCCTGGAGCG
CCGAGCTGCCTACTTGCAGCTCTTCCTCGCGCGCATACTTCGTCTGAGCTTCCAAGGCGTGCTCGACCAGGAGATCCCTCTCACGGCGGAACCGCATGTC
CGAGACTTCCTCAAACTGCCTGCTGTCGAGTGGATCGTCGTCCCATGGAGCAAGCAGTCGCCAACGCCCAGGGCGGCGCGAGATGGCTTCCGCTCCAACT
TTTCGCTCTCTCCGACGGCGGCCTCCGAGTTTTCACCCCGGTACAACGTCTCTCCGCGCCGCAATCCACGCTGCACCCCGACCGAGTCGACGGTGCACCG
ATACGAAAGTTTCCTCCTGAAGCGCAGTGACTCCATGTAGTTGCAACGAGCGCGAGAAAGCCAGGAAGCTAAAAGACAGTAATAACTTATGAGCGCTTTG
TTTTCGTTTCAGTTGTCTCACACGTCGCAGGTTCATGTGTGTGACGTGTGAGAAATTGTCAATATGCATAGTGATGCCACAGAGCAGGCCATTATATTGA
GAAAGACCCGCATGGAGAAGGCGGAGGTGGACGAGCTGCGGGGGCTCACGCAGCGCGTATGTG