Description :
From Genome Similarity Track
Location :
Scaffold_14:736122- 737213
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08589hypothetical protein

Sequence
1091 bases(100 bases per row)
CCATTCGACCTCCGCTAATGGAGCGCGACGAACTGCTTAATGGATTCCTGCGAGCGGAGACCCTCATTCACACTACATGTCCGTCAAATGGCTCAAGAAG
CGTCGACAAATACAACGTGGATATGGAGGACTCTAAAGGTGAATGCCTTGCAGATGAATCCGACGAAGGAGAGAGAACCCTGAGTTCCTTGCGAGGTACA
TATATTTGGCTACTGATTCGAATCCAGCCTTTAGACAGAAACACACCGAAGTTCATTTTGAACAACACCGAGACACTTCGAGTACAGTACCAGATTTCTA
CTTCAAGCGAGAGTTTCTGCCTCCCTGTTGATCATACTAACGTAAGTGAGAGCCTGTAGTTGCCTTCGTATTTTGATGTCTAACACGTTCACTCAGGTTG
TCAAACTTTTAGTAACAGATGAACTAATCGACCAAGTGGATACAAAAATGCTGCAGTTTACTTTCCTTTCAGTGTCCCTAAGTGCACCTGAGTCACCCCC
AACAAAAAACGCTGAAGCAAAGGTTATTGCTCCAACGACTACAAGTATTAACTATAGTGATGCGGCGCTAGCTGCCAGTGAAGCTGCAGTAGCTGAGGAA
ATTCATCGGAGGCAACGGGTTGAAGCCGAACTGGATGAAGCGAAATCCGCAGCTCAAGCAAAAGATCGAGAACGTCTGGACGCTCAACTCCAAGCAAAGC
AGGATGCACAGCGAGCTCAAGAACTTGAATTGGCGCGAAACGAACAGGTGTACGCACGATCGTTGTTGGAGCAGCAGTTAGCGATCCGAGAACAGCAAAA
CCAGGAGCTGATACAAGCCCGCAAACAGTTGGAGGACCAGCTCCAAGCTACGAACGAGAGTGCCCAGCGTTTTCAGATCAATATCAACTCCACTGACCAA
GCTCTCGAGGTAATTAACGATGAATGGTGATGTAAAATGATTTTCCTAACACTTGCTTGTTGGATAGATGCTGAAACAGCGCGCTATCAGCGATGCCAAA
GAGCGCGAAGAGCTTCAGAGACGACTACGCTCTCTCGAAGAGGAGAAGCTAGCCTTGCAGAATAAAAGTCGTGCGTGCACGATTCAGTAAT