Description :
From Genome Similarity Track
Location :
Scaffold_85:73601- 77484
Transcript NameFunction/comments
Phymu_g3855inositol-3,4-bisphosphate 4-phosphatase, putative
Phymu_g3856hypothetical protein

Sequence
3883 bases(100 bases per row)
CGGACCCGTCGCGTCTGTCGGACATGACGCAGCGTCTGAAGCCGAAGCTTAAAGTGTCGGAGAGCGGCCGCTTCGAGGACCAGTTCTACCACGCACACGA
CGGGAGCAAGGCGATGGCTAGACTACGTAAACGCGCATACCAGAACAAGACGGTGCACATGAGTGGCAACGACGTGGAACAGTTCTCGGACGCTGATATC
ATTACCAGCGGCTATCTCGTCAAGCAAGGCTCCTTCTGGAAGTCCTGGAAACGCAGGTTCTTCATTCTGAGAAGAGACCGACCAGTGCTGTGCTACTACA
TGTcggctgaagagctggccAAGCTCGGAGAGATCACTATTGATGAAAACACCAAGGTGGAAAAGGAACCCACTCCCAAGGACAGCTTCTTGTGGAGGTT
CACCATTGAGAACGAGGGGCGTAAGCTCACACTGTCTGCGGAGCGAGGAGACCAGCAAAAGGAAATCATGGACGCGTGGATCTCGTGCATCAAAGGCTGC
ATCACGCAGCGCGCGCGATCGACGTCTCGTGCGACGATGAATGGGTCGTTCGATCGCCGATCGGAAGGCGGGTCCTTTCATACACAGCTGCAAGCGCGCG
TCTCGGAGAGTTCACCTATGCTGGATGACCTTGATGCGGATCGTGCGAGTTTTTCGCGTATGGAGAACCCGCACATCGCCAGCGGCATGAACACGATGAA
ACGTTTCTCGACGGATACGACAGTTATCCAGCAGGCTGCTAATGACTCTAGATCCGTTCgggagaacgaggagaagaaaaagaagcaaCATCAACAGTCC
CGACAGCACCGAAACTCTCGTTTGACCAGTACTGCTTCCGCTCCATTAGATACAGCGAAAGCTAAGCCCCGGCTGGTCCGCTCGTCCAGTGCTGGATCTA
TCCTTACGCAGGCAGCGTCGTTCTCCGTTGCTCCTCGTGCGTACGACGATAATGGCCTGTCGATGATGCACTCGCCTTCTCATTCAGCTAGTGATCTACA
GGTGACGCAGGTTACGTCAAACTCTCCACGTGCTCCAAGCCTAAGCTTGCCAGGATTCAAGCCCCGCCCCAGTGTGGAGTTAGCTGTGTCTGTGGGCAGT
AAGGCTGTGCAAGATGTCCCGCAGATGTTGGTGGTTTTGTTCAACATTCGCCAGGGGCAACGACCCGAAGAGATCTCACGAACGGAAATCCGGAGTTCAC
TTTCACTCCGATCTTGTGGTGGTGACTCTTACGCCCGTGATTTCAATGCCTTGCTGTCGGTACCGCGTACGGCGCGCTCGATGCTGCAATTTGAAGTATA
TTCAGTGGTGAATCCTTCTTCGGAGGCTCTTGAAAATCAAAAGTCGCTCGGATTTGTGCGAATGTCGGCCCTGGACGTCCTTTTCTCTCGTGGATCGtca
atgctgctggagtgcCACCAGCCAGACACATCCAAACAACGTTACTATCTTGCTGTGGACCGGTTCCAACCGCCTAGCCACAGCGTTAACGTGAGCCACG
CGTATACGTACGCAAAGCACCATTTTTTGGTGGAAACACAGGTCatggagaagcgcaagtctGGTGATATTATGTCTAGCTCCACTATGAGCTTAAGGGG
TGGACTGAGCTACAGTGAAATGCTTCGTGGCCAGATGAACTCGTCCGCCAGTCACATATTAGTGACTGAAGAATTGTCGGCGTCTTACGTTTCAGTATCC
ATGACCGTCGCGTTTCTGAAGTATCTCCAACGACGGAATGTTACCCGCATCGACGAGGCTAAGCAGGTGGTCAACGACATGAGACAGCATATCCAGGCGA
ACTCTGGCTCAAATTTGGCGAGCACTCGCGTTCAAGAAGTAGAGGATCGCATGCGGGATGTGGAACTTGAAATGGCTCATTATATCCGGCTTCATGCCTC
CTATAAAGAGAACCTCAAGCGCTACGAAACGATGTTTGCATCGCTTGAAAGTGGACGGGAACAGGGAATTACTGGATGCCTTAAGCGAagcaacatgaag
aaggacaaggccaCGTCATTCATGGCGACTAATCTAAACTGTCATCTTGTGCGCGGAAGGCGTGTGCATCTTGCTGACGATGTCGAGCGGAGTGAGCAAG
CTCGGAGAGGGAGCTTaacgtccacgtcgttggATGATGGTTCTGGATCTGAagacagcgacagcgagaCATCTCCTACGTCTGAGTTCGTGTACTCCGT
TGTCACTCACGGTTGTGCTTCAGCGCATATTATGGGCTTTAAAGAGGGCGGATtacgtcgtcttcagcagcagctggccTCGCAAAGTCTCCCTGACCCG
CGTCTTCGTGAACGTATTGAAATGAGAGAGGATGTGGTGCGTTCTCAAGTGTTGGCAATCGCTGGTGCTTCGTTCCTCAACGCGGTGGGCCTGGCAGCAA
CTCGTGGGGGACAGCACCGTCAGCGGTTGCAACTTGCCTGCTCAACAGGGTTCTTGCTCAGCATCGAATCATTGCTGAGTACCGTTGGCGCCGAGAAGGG
TATGCTTGAAGATATGTCGGAGGGTATTCGGTGGCTTAACAGTGCAGTGAGCTTTCAACTTGTCCAATCTGGAGAAACCAACCCTCACATGGAGATGTCT
AAGTGCGTCAGCGTGACAAGCACGCCAACGGGAGATCATGTCGTGGTCGCATTCGCAGTGCCGCCTGATGTTTTCTCTAAACTTCCGGATGTGATGCAGC
AAGGACATGCTCTAAAACTCCACGGTGTGATGTTTACTCAAGGGATCAACGAGATGCAGTCCGTGGCCAATCACTACTTGAATTCCAGTCTCCAGGATGA
GCTGAATTTTGAGAGCGTGCAGATGCTACAGCGATATTTCCGCGTCTACCAGACTCAAGTGGGTGCTAGTGGGGGCGATGACAGGAAGCGTGACACGGAT
CTAGCTGAGTTAGCCGAACTTCAGGCAGAAATCGAAGCCCTCACTGGTCGCCTCAACACTCGCACAGAGAATGTGCAGAAGAAGTATGTCAATATTCTCA
TCGCGTCCAGCGATATCTGCCGCCGTCTAGGAGCCGGACGCACGACGTGCTGCAAGAGTGGGAAGGACCGCACAGCGATGtcggtgacgctggagacaTC
TCGGCTGCTCGTGGACCATTTCCACGTAAAGCAGGGCGTGCATCTCTGCAACGCCATGAGGGAACGAGGTGTTCGTCGTGTGAATGTGCTGGCCAACACT
GGCAAGACGAAGTTTGCATTCAACTCGTTCCAGCTCAAGTACATTCCTGATTGCTACAAGCCGCCGCTTGCCTGCGCAGATTCACACGTTGCCTCTTAAC
AAAGCTGGATGAATGGTCAGAAAAGGTGAGCTTTACCATGTTCATAAACCCTAGTTTGAGTTCGTTGTACGCTGTAGGATCGAGGTGTCAATCCCACAAT
GGATCGTTCATCATTTTGAGCTCCTTTTCTCGTTTCCGGctacgctgcagcttctggacCTGTTATCGCCCCTCACGTTAGCGTTTCCATTGGTAAGATG
CACAATTTGTGTGCCAGGTACGCACCGCGAATCGAAGTTTCTGCTCGTGCTCGCGGTTGCtctcctccagttcttcaactTTAGCTTGGAGGGCAGCCAC
CTGTGGATTGAAGTGCAAGGCTTCGTGGAGCTGAGTCTCGAGCTGGCTGATCTGCTCTAGGTACTTGTGACGGAGCTCGTGCTGACAAAACGAAGAATGA
GATGCTGATTCAACGCGACAAGCATTGTGCTTTCCAGTTTACCTGCTGATGAAGCAGTTTGGCCGCGATTTTCTCCCCTAGGTCTGCCGCTTCTCTGCGT
TGGGTCCGCAAGGCGTCATGTTGCTCTAACAAACGAAGTAGCAGTTCGTCTTTTTCGCGGGACCCTATTTTCTGCAGTGCTGC