Description :
From Genome Similarity Track
Location :
Scaffold_48:736- 2822
Transcript NameFunction/comments
g9965.t1POM72870.1 Hypothetical protein PHPALM_10354 [Phytophthora palmivora var. palmivora

Sequence
2086 bases(100 bases per row)
GCAGAGTCGCAAGCTCCCTGTGGCACGCGGGATGGCGTGAAAACGCCGTCTTCCGTCACGAAACTGAACAGCTCCCGGCTGTTCGGATGGAGAGGCATCT
GCCAGAACCCTTTGTGGAAGTCAAATGCACCAAATCCGTACGACCCACGCACGGACTCCGTCACCACGGCGAGATTCGGCGCAGCACCAGCCAGTGGCAC
CGTGAGCCGATTGACGGGCCTGTAGTCGATAGTGATTCGAAATTCATCCGTGCCACGTTTAGCTACCGGCAGCGCGGGACAGGCCCAACGACTCTGGGTG
TTCCGCTCAACGAGTCCTGCATCCTCCAGTTCTCGCACATACTCCCGAAGAAATTGGCGCTGAGCCTCAGGATAGCGCCGGACGCCGCTACGATACGGCT
GCACACCGCTCTCCAACCGCACTTCGAGTGGTTGGACATCTGCAGCTTCATCACGGCCAAGGCGGACCCTGAAGACGTCGGAGTATTCCAGCACCATTTG
CCGTAGTTCATCCGCCATAGCCGGTTCAAAGCCGGCTTGAATGGCCTCATCGACCATGTTGTGCAACAATGTATCGACCTCATTGTCCTCACTATTTCCA
AGCACATCCATGTGTTCGCACGGGATGTCATCAGCTTCAAACTCGGCGGCCTCAATGTGCTGTTGAGCCAACTGCTCGAAAACCCCATCAAGGTCCACGC
CGATCGATTGCAGTGTCGACTTGCCGAGCAACAGCTCCTCCTCGGGTGCTTCAAGCACAAGGCACTCAATGCCGCTCAAGCGCAATGGCCCCGCCGACGT
TACGATTTGCACATCGAGATGTATTTTCTCGTGACAAAGCATCGCATTGCCGCCAGCAGCGACAACCTCCAGCGGTGGATCAATAATCACCGTTGACAGC
TCTGGCAACAACTCCCTGAGTTCGGCCATCACTGGGCGGCCAATAATGTTGACGTCAGAGCCCGTGTCTGGGCAGTAAGGAACGTCCAGCACACCGTTGA
TTACAGCACTGCGGAAAGCTGGTTCCCCATCGGTTGTGATCCTCTTGACACGCTCCTGCGCACGACTCCGTTTCTCACGCAGCATCTTCTCCACGTTGGC
CTTCTGCTCCGCTGTTGCCGTCGGGCAATCTCGGGCCCAGTGAGGCCCCTTACACACCAAGCACCCGTCGCGAGGAGGTTTCCGGGGGCCCGCGGCACCC
CGACCACCGCCCTGGATGCTCGATGGCTTGGGAAGTTGCTTTGCAGGTCGACCGTGCGCTTTGGCTGCCGCACCGCCGTCCTCCTTCGGTCGCAGACTGG
AGCTTTGCTTCATCTCATTCTGCATCAAATAGTACTGCTGCTGACGTGTCGCTCGCTCAATCATCAGGTCATGAAGTGCGAGGTCATCGACCTTCGCTTC
GCGATGGGTCAACTCGACCAACCGAGTCAAGTCGACTTTCAAAATCTCGGGGGTCACGTGTGTCAGTAGCAGCTTGCATCTCATCTTCAGTCTCTGCCGA
CCCGCCTCACCAACAGCTGGTCCACGGCCCAACATACCAGTTAGACCGTTGTCTTCGACCAGTCTGTCGAAGCCCATGAAATATTTGCGATCCGGGCTTC
GACATCGACCTCTTCCAAGTCCATCTTCAGCTCAGCAAAGAGCCGGGACACATCGGGGACTCGGTCGTTCACCATTCCTCCAACCCTTACGCTTCATCTC
TGCTAGAAGCATAGCGTCGGTCACACTCTCCACTTCCTTCTGAGAATGTAGTGAGCCACATGCTCCAGTACCCGGGGTTTCAAAGACGTCCGGATACTCC
TGGCCACGGTTTCTTGGACTTCGCCCGTGGTCGAGCACCGCTCAGCGATCTTGGCCTCATACTGCCTGCGCTCTCGAATGAACGTAGTGATAGCAGCCTG
GCTCCACACGGCAAGCTCCGGTGCAGCCACCACCTCAAAGATCGGCTGAGGCACGGTCATCCTGACGTCGCCCTCTGCGTCGTATTCGTAGTCCACCATG
CCTGGCATTGCGATGCTTGTACTTGTGTTCGTCAAAGAATTCTTTATGACGTTGCGCGCTTCAGAGTAAGTTGCGAAGTGAGTTCA