Description :
From Genome Similarity Track
Location :
Scaffold_201:7359- 11747
Transcript NameFunction/comments
Phyci_72655Hypothetical protein
Phyci_291357Hypothetical protein
Phyci_185834Hypothetical protein

Sequence
4388 bases(100 bases per row)
CGCGATGCATTGGTCAAGTGGAAACTGGCACGCAACGAGTACGAAGAGACATTTCGTCAACGCTGCCTCGAGAGCAAGGAACGCCCTGAGGTTGCGATGA
AGCCAGTGAAGTCGTCCATTGCCCGCGAGTTGCTGGAGGTGATCTGCCTTTATGAACTGAGGAAGACGATGGACAGTGTCAGCACTGAGGAGCTCCTCAT
GCCGATCAAGCAACGCATCGGCAAGGTGAAGAATGAACAAGTTCTTGATCTGGACGAGCTGTTCAAGCGGAGCTTGAAGATCGACCTGAAGGAGGACGAT
ATTGACGCTCGAGTGCTGAAATATTACCGGGATTTTTCAACGATCATAACAAAACAACGGATTGGCGAAGAGCTTGGGCGTCGGCGAGCCGGATGCTGAA
GGTTTCGTTGACCGCATGAAGCTACGCTGCACGATCCTGATCGACAATTTGGAACCTCGAACGGTGCGTGAGGACGTCAAGCGGTATTGCAAGTACGAGT
GTAAGGAGGCCAAGCGCAACGACTTCATGTTGTTCAACATCATCAAGGAGAAAGCGAGGGCGCAGCACAAGTATCACATGCTGACACTCGAGCAGAAGCC
AAAGGCATCACCGACTCAATAAGCGGGTGGTGGAGACATGAAGGCCGCGCCCGCCACAACGGCTGGTAGCAAGTCTTCTATGTCGCGTATTGCAGTGGCA
GCCTCGACGCAACCACTGCGCAAGGAGCCGAGGGCCTCGGCGAAGCCGCCCAAGACGCTGCCAAGGTGCCCACTGGCGCAAGGACTGTCCGACCGCAAGT
GACGATGATGGTGCCCGGGCTGTGGAAAAGATGCGCGAGGTGAAGGAGAATGTCCGTGCGAAGAAGGTGGCCGACTCTCCAAGTACTGGTGAGGTTGTGC
TGAATGTGCTCGTGACGCTCCCGTACCTTGCAGACTCGGGCGCGGGCACTACCTTCATCCCACGCCTGGCAGTTGACGAGTTGATGCAACTCGGCAGTCG
CCTGGAAACGTTCCCACTCAGGACGCCGATTCACCCGGAGGTTGCAGGCGGTACCACATTTACCTGTAATGACTCGGTGACTGTGGACCTCTTGCTGCAG
ACGGCGGCGGGAACCGTCCGCCTGCATGACGTGCAGTGTCTCGTGATGGAAGGGCATGAGCCTGAGTTCATTCTTGGTATCGACGCCCTGGTGGCCATGG
GAATCGACGTCAACCATCAGCTGGAGCAGCTGGCGACTGGCAATTTACCTGCAGACGATGATCCATTCGATGAGGAAGATGACGCCCTGGATCTGTCTCG
ACAGGAGATCCGAAAGAAGCTTGATGAGCTGGTGGTGGACGGAGGGCAGTGTGGCTTTAGTCCCGCGCACATGAAACAGCTGCATGACCTGGTGATGGAG
TATGAGGATGTATTTCTCGTCGACCTTGGAGCGGACCCGCCGGCGGACATTGAGCCACTGAGAATTACGCTGGAGGAGGGGGCCAAGCCATTTCGGGCAC
GTTCGCGCGGCTACGCGCCAGCACAGCGCCAATTTCTGAGGGAGTACACAGCCAGGCTGGAGGAGCAAGGTTTTATCCGCCGGAATGACCAGAGCCACTG
GGCGTGTGCTGCAGTACCAGTGGCGAAGCCCCACAAGTCCGGCGAGTTTCGAATGACCGTGGACTATCGCCCAGTCAACGCGATGACAGTCCCCATTGCC
GGAGCAGCGCAAGAGGTCACGGACAGCGCTGAAGTTGCCAAAGGAGCGTGTGGGTACGCCGATTTTGATATGCCTaagggtttctggcaattgccattgc
atcctgacagccaggagatgacgagcttcgtgacgactgatactgtgtacacgccaacccgtgttcctcagggtgtaagtgactccgcgctccatttcca
gagccaaatgcagaaagtattcgcttcgatgctctacctgaacttattggtttgggtcgatgacatcttattgtacgcAAAGACGCCCGACGAATTTCTC
GATGCGGTGCGTCGATTCTTCACGTTGGTCCACCTTCATTGGCTAAAACTGAGTGTGGCCAAGAGCTGTCTGTTCAAGACTGAGATTAACTGGTGTGGCC
GTGTGTTTAGCGGCGTTGGTATCTGCCACGACCCCGACCGGATCAGCGCATTGCAATCCTTGTCACTGCCTGTGACGACGGCCGACCTCCAgcagtttct
gtgtgctgctggctggatgcgtgacactttgatggactttagtcgcactatgcagcctttgcaTGACAAGTTCGAGGGGGTTCTGAGCGTCGCAGGTCGC
ACGAAGGAGCTAGCGGCCGGTGTACTGCTGTCGTGGACACCTGCGGAGGAAGCAGCATTCGTCCGAACCACTGAATATTTGAGGTCTTCGCAGACATTGC
ACTTCCCAACATCATCGGCTGTCCTCTGTGTGTTTGGTGACGCGTCTGAGCGTGGATGGGGTCTGGTGGTGACGCAGGTGGCGCACTGGAGCGGCGGACG
CCCCGCTCCGGACCAACAGAACGGGTTGCTGGTATTCAAGAGTGGCCAGTTTGATTCAACAGCTCAACGATGGAGTATCATCGAAAAGGAGGCATTTCCG
ATTATCTGGGCAGCGAGTCCCctcgaatatctactcgtgcgacctggtggatttcacctctactgcgaccacaagaacctgatctatgtgttttctcctg
tgcatgaagtgaaacgacatgttcgagggaagctacaacgctgggctctttcgttgactggcctcacgtaccagattgagcatatcgacggcatggcaaa
cgtatgggccgaccttctatctcgttgggGCGCTCCTTCTGAAGAGGAGGTGGGGGTGGTAGTGCGATGCAAGTTTGTGACTCGCAGTCAGCGCCAACTA
CTGCAGTCAAACGATGCTCAGGGGAGCGAGCTGAGACCCCGCCAAGGCGATTTTGTTTTCCCGTTGACGACCGAGATCCAAGAACACCAGGCCAAATACA
GGAACGATGCACCTCCTGCGGCGTACCGCGGCGAAAATGGCTACATCGTCATCGAGGACCGCATCTGGGTCCCAAGCGCAGCAACGGAATTGTTGCAACG
CATTATGATCGTTGCTCATTGCGACAGCCAAGGACATGTGGTCTAGATCCCATGGTGACCACCATCAAGGAGACTTTCGAGGTTGACAGCCTGGATCAAT
GCTGTCGCCGATTTCTGAAACGATGTCTTCGATGTAAGCATGTCAAGGGAGGAAATATCATCCCAAGACTGCGGGGGCCGACGTACAACCCGACGCTGCG
CAACGAATTGCTACACTGGGACTACCTCTACTTGGGGATCAACCTCGACGGATGTGCATATCTGTTGGTCTTGAAGGACGGAATTAGTcacttttgcgag
ctggttgcgtgcgattccgcaacgagtactgttgccgccacggcccttgccgactggactaaaaggttcggtccacctgaagtcctggtgtccgatcagg
acagccactttaaaaatgaggttgtccgccaagtgtgcaagcgcatgtcaattgaacaggatctggtgttagcttacgccccctggatcaacggaactct
tgagcggctcaaccgggatatccttcaagttttacgcgtcctgctgatggaactgaagcttgatacacatgaatgggaatatttggttccgttggtgcaa
gcgaatttgaatcatactccggttgcatcactcggtggcaagtctccgagtgagctgtttacagcgctgcctagaccctcaccttttgcGCCGATCGTCA
TTGAGCGAGGTGGCAGGACTGTGGTCGTCGATGAGGAAGTGGTCCTGCCAGCAGAGCTGGTGGACAAGTTGCGCCAGAGTCTGGCCGGCATGCACCGTGA
AGTGCAGGACTTGCCGGAGAAAAGACGTCTGGGGAACATGCAGCAATCACGGGGGTCTCCTTGCAATTTCACGGTCGGCGATTTTGTCCTTTGCTCGCGT
ATCGACTCACGCCTGTCGGTTAACAAGCTGCTGACCCGATGGGTAGGTCCGTTCGAGGTGATTGAGGAGCTACTTCACTCGTTTGTGATCCGTCACCTGC
TAACTGACCAACGCTACAACCTCCACGGATCGCGGCTTAAATTCTACTGTGACGCCAGTCTGGGAGTCAGTGAAGAAATGCGTGCTCATGTGGGTAACCA
AGGCATGGTGCTCGGCGTGGAGGCTCTGAAGGGTCATCGCAAGCAAGGCACTCAATGGCAGCTACTGGTGTCGTGGATCGATCTCCGAGGAGAAGAAGAA
GAAGACTCCTGGGAATCGCTTGATGCCATACATGGCGACTTGCCGATCCGAGTTCGGGAGTACGTCGATGCCAGTGGCGATGAAGCAC