Description :
From Genome Similarity Track
Location :
contig_17:735822- 738826
Transcript NameFunction/comments
g5136.t1CAI72306.1 putative polyprotein [Phytophthora infestans
g5137.t1OWZ06963.1 LOW QUALITY PROTEIN: reverse transcriptase [Phytophthora megakarya

Sequence
3004 bases(100 bases per row)
TCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCCGCTTCCCGAGATCAAGTCGAAGCGATCGACGCTTCTTCGAAGG
TCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCACGTTCTGCGTGAAGAAAGCCACCGGCGGATGGCGGATCGTCCACGCCT
TCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAGACATGGTGCTCGACACCATGTCCGGCAGCACCAAGTTCAGCGCCAT
CGACTGATGGATGGCTTCTACCAATCTTGATGCGCGAAGCCGACGTGCCGTTGACTGCCGTCAGCACGCCCAGTGGAATGCTCTGGGAATGGCTCGTGAT
GCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAATCTGCTCCGGCGTTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCT
TCATTCACAGCGTGCCGCGGGCGGCTGACGGACGTCGAGATGCACCTTCAACACCTGAGGCAGGTGTTCGAAGTGATGAGGGAGAACAAGCTGTATGCCA
ACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCACGGAAGGTGTCCGTGCTGACCCGGAGAAGATCGAAGCCAT
CTGCGCTTGGCCCGCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTTGGTCTCGCGACGTACCTCCACCACTACTCGAAGAACTTCGCGGCAACGATCCG
TCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTCTGAGCACCAGTCGGCTTTTGACGCGGTGAAGACGAGCTTGTCCACCGCGCCCG
TACTCATGCCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTTCGCGATCGGCTGCGCCTTGATGCAGTTCGATGACGAAGGGC
GCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAATTATCCGGTCCATGATAAGGAGCTGCTGGCCATGCGGTACGCCCTCAT
CAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGACCACGCGTCGTTGAGAACAGCGACGAAGAGCCCTCACTTGTCCCAGCGC
ATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCACTACAAGCCGGGCAAGGCCAACATCCTCGCCGACGCGCTCTCGCGTCGGCCAG
ACTACGTGCAGTCGGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTGCGCTGTGTGTGTTGCTGAAGAGGTCGCTGCAGTGGAAGTCGCAGCGAC
TACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGCGTGCTCCGAGATGATCAAGTACTTGGGAGACCCGTCCGACACGGCGCGGCGC
CGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAAGGAGGCCTGCTGACATACAGCGTCGATCGCGCCGATCCGCCGCGCATCGTCG
TCCCGCTGGACGATGACCTTCGGGCTCGGCTGATTCACGAGTTCCATGACGCTCCCAGCGGCGGCCACCTCGGACGCGAGAAGACTTTCGCGTCGCTCTC
GCGAGACTTCTATTGGCCGCACATGTACAAGTGGGTGCGGAAGTGGGTACGCTCCTGCGAAGCGTGCCAACGAGTCAAGCCGTCGCAGTCGAAGCAGGCC
CCGCTTCGACCCCTCCCAGTTGCGGCGGATCCGTGGTCTTCCGTGAGTATGGACTTTGTCTTCGGGCTGCCTCGAGATGCTCAAGGCCGCACTGGGATTC
TCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCATCTTGCTCCGGTCGCTGTCACCATCACCGCGGCGCAGTCCGCGGCGATCTTTCTCGACATCGTCTA
CAGGCACCATGGACTGCCGACCTCGATCATCTCCGATCGCGATCCCCGCTTCACCGCCGCATTCTGGACCGAGCTCTTCAAGCTAGTGGGGACGCGGTTG
AAGATGTCCACCGCGTCACACCCAGAGACGGACGGCCAGACCGAACGCGCAAACAGGGTCGTCGAGGACGTGCTGAGAAGCTTCGCCACGTCGTTCGAGT
CGTGGAGCTCGTTCCTGCCTATGGTTGAGTTCGCTCTCAACAACGCCGTTCACACGTCGACCGGTCTCACGCCATTTTACGTCAACTACGGTCGCCATCC
CCGCGTTCCAGCGCTCCTCGGCATGGAGCGCTCGATTCCCCAAGGCGGCGCTGACGACGAGAACGACTCGGCGCACCTTTCCAATGCCGACCAAGTGCCC
AGCGGCACTGAGGCCGCTGACGGCGCTACCTCCGCCTTGATGAACGGTGTCACGACTCGGCACGGTGCCCGAGCCTCAACTCGAGGCATGCGTACGCGTG
CCGCCACGAGGGCGGCACCATCCGACATCGCATCTTGGACACGTCGGACGCTGATCAACCCACGTCAGCGTCCTCGTGCAATTGCATATGAAGACACGTC
CGGCGCGGCGACCCCGCCCGCGCCGCCTCCAGCAAACTTTGACCCCATTCCGTCCCCACAACCGCGCGACACAGCGGCTGTCAGCAAGTTCTTGCAGCGA
CGCCAGAGTGTGGCGCGCTATGTTCGTGACGCGATTGCAGTGGCAGTCGATCGTCAGAAGGAAAACGCTGATCGACGCGGCCGCAAGAACATGGAGAAGT
TCGCCGTCGGCGACCGCGTCTTGCTATCGACGTCCGGCATTCAACCCATTTTGGTTACCAATTTGGGCGCGAACAAGCTCGCGCCAAGGTATATTGGACC
ATTTCAAGTGTTGAAAGTGTTAGGAGATGCCTACACGCTACAGCTACCTACAGCGCTCCGGCTTCATCCTACTTTCTACGTCGGTCGGCTGCGGCGATAC
CATC