Description :
From Genome Similarity Track
Location :
Scaffold_1093:7358- 9201
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1093-fgenesh-gene-0.1Heat shock protein 70
Pytar_ATCC12531maker-par_contig_1093-snap-gene-0.4NAD-specific glutamate dehydrogenase

Sequence
1843 bases(100 bases per row)
GCAGAGTCGGCCATGTACATCTTCTGAAGGATCGGAGTCGCCACGTTCTCCAGCTCCTTCTGCTTGGCGTCATACTCCTCCTTCTCGGCCGCCTGGTGGC
CATCGAGCCACGCAACCACCTCGGCAATCGCATCGCCCAGCGTCTTCTTGTCCTCGTCGCCCAGCTTCGCCGTGACCTTGTCGTCCTGCAGCGAATTGCG
CAGCGTAAACGCGTAATTCTCGAGCCCGTTCTTGGCCTCCACGCGCAGCTTGTTGCGCTCGTCTTGGTCCTTGTACGTCTCGGCCTCGCTGACCATGCGG
TCAATCTCTTGCTGCGAGAGACGCCCCTTGTCGTTCGTGATCGTAATCTTGTTCTCCTTGCCCGTCGACTTCTCCACGGCCGAGACATTGAGAATGCCGT
TGGCGTCAATGTCAAATGTCACGTCAATCTGTGGCACGCCGCGTGGCATCGGTGGCAGCGCATCCAGCGAGAACTTGCCCAGCAAGTGGTTGTCACGAGT
CATGGTACGCTCGCCCTCGAAGACCTGGATCAGCACGCCCGGCTGGTTGTCGGCGTAGGTCGAAAAGGTTTGCGACTTTTTCGTGGGCACGGTCGTGTTG
CGTGCAATCAACGTCGTCATGACACCGCCGGCTGTCTCGAGCCCGAGCGACAAGGGCGTCACATCCAGCAAGAGCAAGTCCTGCAGCTTCGACGACTTGT
CACTGCCACTGAGGATCGCGGCCTGGACTGTGGCCCCAAATGCCACGGCCTCGTCCGGGTTAATGCTCTTGTACAGCTCCTTGCCGTTGAAGAAGTCCGA
CAGCAACTGCTGGATCTTGGGGATCCGCGTCGAGCCGCCGACCAGCACGACCTCTTGCACTTGGTTCTTCGAGAGCTTGGCATCGCGCAGCACGCGCTCG
ACCGGCTCCATCGTCTTGCGGAAAAAGTCGGCACACAAATCCTCAAAGCGCGCACGCGTAATCGTCGAGTTGAAGTCCACGCCTTCGTAAAGCGAGTCAA
TCTCGATATAGGCCTGCGCCGACGACGACAGCGTGCGCTTGGCACGCTCACAGGCCGTGCGAAGTCGACGTAGTGCGCGCTGGTTCGACGTCATGTCCTT
ACGGTGCTTGCGTTTGAACTCGCCCACGAAATACTCGACCAGGCGATTGTCAAAGTCTTCACCGCCCAAATGGGTATCGCCGGCCGTTGCCTTGACTTCG
AAAATGCCTTCTTCGATCGTGAGCAGACTCACGTCGAACGTACCGCCGCCCAGATCGAAAATGAGGACATTGTGCTCGCCGCCCTTGCGGTCGAGTCCGT
ACGCGATGGCCGCCGCCGTCGGCTCGTTGATGATACGGAGCACATTGAGGCCAGCAATGGCCCCGGCATCCTTGGTGGCCTGGCGCTGCGAGTCGTTGAA
GTAGGNNNNNNNNNNTCACGGCGTTCTTGACCTGCTTGCCGATAAACGCCTCGGCAACGTCGCGCATCTTGGTCAGCACCATGCTCGAGATCTCTTCGGC
GTAGAACTTCTTCGTCTCGCCCTTGAACTGCACGACAATCTGCGGCTTGTTGGCCGAGTCCGCCATGACCCGGAACGGCCAGTGCTTGATGTCGGCTTGC
ACGACCGCGTCCGTGAACTTGCGTCCGATGAGACGCTTGGCGTCGAAGACGGTGTTGTGAGCGTTCATGGCGACCTGGTTCTTGGCGGCGTCCCCAATCA
GACGCTCGCTGTCGGTGAAGGCCACGTACGAAGGGGTCGTGCGGTTGCCCTGATCGTTGGCAATGATCTCGACGCGGTCGTTCTGCCAGACGCCGACGCA
CGAGTAGGTCGTGCCCAGGTCAATGCCGACCGACTGGCCCGTG